View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13178_low_14 (Length: 257)
Name: NF13178_low_14
Description: NF13178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13178_low_14 |
 | |
|
| [»] scaffold0086 (1 HSPs) |
| |
|
| [»] scaffold0429 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0086 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 257
Target Start/End: Original strand, 29010 - 29250
Alignment:
| Q |
17 |
ttatgtaggagttatggggtttgaattctgctactaacaagtccctctccccttaacatatcaactactaacattagcctgaaaaataatcatcaattat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29010 |
ttatgtaggagttatggggtttgaattctgctactaacaagtccctctccccttaacatatcaactactaacatttgcctgaaaaataatcatcaattat |
29109 |
T |
|
| Q |
117 |
gctattgattcagcagatgctccttttactnnnnnnngactcaaagatttagacattaagtagctgcagcatagatatagcagaccaaaatgacattata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29110 |
gctattgattcagcagatgctccttttactaaaaaaagattcaatgatttagacattaagtagctgcagcatagatatagcagatcaaaatgacattata |
29209 |
T |
|
| Q |
217 |
tttgcgcttaaattatattcaaaagacataatatttgaaga |
257 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29210 |
tttgcgcttaaattatattcaaatgacataatatttgaaga |
29250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0429 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: scaffold0429
Description:
Target: scaffold0429; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 15 - 137
Target Start/End: Complemental strand, 9952 - 9830
Alignment:
| Q |
15 |
tattatgtaggagttatggggtttgaattctgctactaacaagtccctctccccttaacatatcaactactaacattagcctgaaaaataatcatcaatt |
114 |
Q |
| |
|
||||||||||||||| | |||| |||||||||||||||| |||||||||||| |||| ||||||||| ||||||| |||| |||||||||||||| || |
|
|
| T |
9952 |
tattatgtaggagttctagggtccaaattctgctactaacaggtccctctccccctaacgtatcaactattaacatttgcctcaaaaataatcatcagtt |
9853 |
T |
|
| Q |
115 |
atgctattgattcagcagatgct |
137 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
9852 |
atgctattgattcttcagatgct |
9830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University