View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13178_low_17 (Length: 224)
Name: NF13178_low_17
Description: NF13178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13178_low_17 |
 | |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 33 - 212
Target Start/End: Original strand, 15658541 - 15658720
Alignment:
| Q |
33 |
cagagcagttttggagaaatggggttgcacaattatgactgatggttggactgataggaggagaagaactatattgaattttttggtacgtagtccaaag |
132 |
Q |
| |
|
|||||| |||| ||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15658541 |
cagagctgtttgggagaaatgtggttgcataattatgactgatggttggactgatagaaggagaagaactatattgaattttttggtacatagtccaaag |
15658640 |
T |
|
| Q |
133 |
ggaacttttattttaaagtctattgatgcatctgacattaccaaaattgctgataaattttttaagatgattgatgatgt |
212 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
15658641 |
ggaactttttttttaaagtctattgatccatctgacattaccaaaactgctgataaaatttttaagatgattgatgatgt |
15658720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 40 - 212
Target Start/End: Complemental strand, 246014 - 245842
Alignment:
| Q |
40 |
gttttggagaaatggggttgcacaattatgactgatggttggactgataggaggagaagaactatattgaattttttggtacgtagtccaaagggaac-t |
138 |
Q |
| |
|
|||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| | |
|
|
| T |
246014 |
gtttgggagaaatatggttgcacaattatgaccgatggttggactgataggaggagaagaactatattgaactttttggtacatagtccaaagggaactt |
245915 |
T |
|
| Q |
139 |
tttattttaaagtctattgatgcatctgacattaccaaaattgctgataaattttttaagatgattgatgatgt |
212 |
Q |
| |
|
||| |||||||||||||||| |||||| |||||||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
245914 |
ttttttttaaagtctattga-gcatcttacattaccaaaactcctgataaaatttttaagatgattgatgatgt |
245842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 34 - 212
Target Start/End: Original strand, 244473 - 244657
Alignment:
| Q |
34 |
agagcagttttggagaaatggggttgcacaattatgactgatggttggactgataggaggagaagaactatattgaattttttggtacgtagtccaaagg |
133 |
Q |
| |
|
||||| |||| | |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
244473 |
agagctgtttggaagaaatatggttgcacaattatgaccgatggttggactgataggaggagaagaactatattgaattttttggtacatagtccaaagg |
244572 |
T |
|
| Q |
134 |
gaac-----ttttattttaaagtctattgatgcatctgacattaccaaaattgctgataaa-ttttttaagatgattgatgatgt |
212 |
Q |
| |
|
|| | |||| |||||||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
244573 |
gagcttttttttttttttaaagtctattgatgcatctgacattaccaaaactgctaataaatttttttaagatgattgatgatgt |
244657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University