View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317A-Insertion-27 (Length: 101)
Name: NF1317A-Insertion-27
Description: NF1317A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1317A-Insertion-27 |
![](./plan/images/spacer.gif) | ![NF1317A-Insertion-27](./plan/images/spacer.gif) |
|
[»] chr4 (1 HSPs) |
![](./plan/images/spacer.gif) | ![chr4 (8-101)||(50527893-50527986)](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 50527986 - 50527893
Alignment:
Q |
8 |
caaacaacatagggttgcgtgcacgactttgcaaaaattagggattccatctgttttttgtagccatgccattttctattgatgaatcggtgca |
101 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50527986 |
caaacaacatagggttgcgtgcacgactttgcaaaaattagggattccatctgttttttgtagccatgccattttctattgatgaatcggtgca |
50527893 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 24942 times since January 2019
Visitors: 1329