View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1317A-Insertion-28 (Length: 134)

Name: NF1317A-Insertion-28
Description: NF1317A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1317A-Insertion-28
NF1317A-Insertion-28
[»] chr4 (2 HSPs)
chr4 (102-134)||(24984094-24984126)
chr4 (8-40)||(24984186-24984218)


Alignment Details
Target: chr4 (Bit Score: 33; Significance: 0.0000000007; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 102 - 134
Target Start/End: Complemental strand, 24984126 - 24984094
Alignment:
102 gataaacaaatgttagtacgttaatagttatgt 134  Q
    |||||||||||||||||||||||||||||||||    
24984126 gataaacaaatgttagtacgttaatagttatgt 24984094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 40
Target Start/End: Complemental strand, 24984218 - 24984186
Alignment:
8 gatgcctctagaaaagacttgttgtattttcta 40  Q
    |||||||||||||||||||||||||||||||||    
24984218 gatgcctctagaaaagacttgttgtattttcta 24984186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University