View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317R-Insertion-10 (Length: 175)
Name: NF1317R-Insertion-10
Description: NF1317R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317R-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 33887555 - 33887715
Alignment:
| Q |
9 |
gatctaacggtgtagtgtcgagctccttaacgtcatcgtcgtcggtttcagtaaccttgccggagctgcagcaagtcaacagcggagtgtgatcggagcg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33887555 |
gatctaacggtgtagtgtcgagctccttaacgtc------gttggtttcagtaaccttgccggagctgcagcaagtcaacagcggagtgtgatccgagcg |
33887648 |
T |
|
| Q |
109 |
aaactcgtcagaagccgacgaaagaatattttctgcagcttcagcgagcgagtttggtagttgatgc |
175 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33887649 |
aaactcgtcggaagccgacgaaagaatattttctgcagcttcagctagcgagtttggtagttgatgc |
33887715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University