View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317R-Insertion-12 (Length: 93)
Name: NF1317R-Insertion-12
Description: NF1317R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317R-Insertion-12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 7e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 7e-32
Query Start/End: Original strand, 9 - 89
Target Start/End: Original strand, 34429599 - 34429679
Alignment:
| Q |
9 |
cgttgattggatatgagttgtatttcagtgttggactattttgtaactaatacattgcttggtactaagcttgaatgtcta |
89 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34429599 |
cgttgattggatatgagttgtatttcactattggactattttgtaactaatacattgcgtggtactaagcttgaatgtcta |
34429679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 2e-29
Query Start/End: Original strand, 9 - 89
Target Start/End: Original strand, 34425025 - 34425105
Alignment:
| Q |
9 |
cgttgattggatatgagttgtatttcagtgttggactattttgtaactaatacattgcttggtactaagcttgaatgtcta |
89 |
Q |
| |
|
||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34425025 |
cgttgattggatatgagttgtatttcactattgaactattttgtaactaatacattgcgtggtactaagcttgaatgtcta |
34425105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University