View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317R-Insertion-8 (Length: 281)
Name: NF1317R-Insertion-8
Description: NF1317R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317R-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 9 - 281
Target Start/End: Original strand, 10386950 - 10387222
Alignment:
| Q |
9 |
ctagagacaactgaaataactaaaattaagtgatagaaacaccacaggcagcatttaccgcctaaatgcattgccttcacctccagatctgccttgagaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10386950 |
ctagagacaactgaaataactaaaattaagtgatagaaacaccacaggcagcatttaccgcctaaatgcattgccttcacctccagatctgccttgagaa |
10387049 |
T |
|
| Q |
109 |
taatgggtccgccgtcggacactctcggctattgaagagctcccgccttctgcagcaccatatatacttttttgagcagtatccaagaaattcttcccac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10387050 |
taatgggtccgccgtcggacactctcggctattgaagagctcccgccttctgcagcaccatatatacttttttgagcagtatccaagaaattcttcccac |
10387149 |
T |
|
| Q |
209 |
tagaactagtgttctggattgcttcctgtgcatcagtctcctcagccttctttatacgtttccatctctcccc |
281 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10387150 |
tagaactagtgttctggtttgcttcctgtgcatcagtctcctcagccttctttatacgtttccatctctcccc |
10387222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University