View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317R-Insertion-9 (Length: 235)
Name: NF1317R-Insertion-9
Description: NF1317R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317R-Insertion-9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 9 - 184
Target Start/End: Original strand, 3423449 - 3423624
Alignment:
| Q |
9 |
atatcgtatcatatttgttatgtgataattcaatcttggttaaagtttattagttaactaacttggagagttagttgagttagtttctaactgttatgtg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423449 |
atatcgtatcatatttgttatgtgataattcaatcttggttaaagtttattagttaactaacttggagagttagttgagttagtttctaactgttatgtg |
3423548 |
T |
|
| Q |
109 |
gatttcaagtaacaggttggttaagacttattagttgatatacttgctatccaagcaagctaaatggttgtaattc |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
3423549 |
gatttcaagtaacaggttggttaagacttattagttgatatacttgctatacaagcaagctaaatgagtgtaattc |
3423624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 115 - 190
Target Start/End: Complemental strand, 109345 - 109270
Alignment:
| Q |
115 |
aagtaacaggttggttaagacttattagttgatatacttgctatccaagcaagctaaatggttgtaattcattgta |
190 |
Q |
| |
|
|||||||| |||| |||||| || |||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
109345 |
aagtaacatgttgattaagatttgttagttgatatacttgctatataagcaagttaaatggttgtaattcattgta |
109270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University