View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_high_18 (Length: 318)
Name: NF1317_high_18
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 117 - 310
Target Start/End: Original strand, 37548549 - 37548741
Alignment:
| Q |
117 |
ttacatggttggtaaagcttggaaatttagaaggggttacttgaattccgtgggttttgatttctgggaatgttgagataatcgtttcaatttgtgtata |
216 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37548549 |
ttacatggttggtaaagtttggaaatttagaaggggttacttgaattccgtgggttttgatttctgggt-tgttgagataatcgtttcaatttgtgtata |
37548647 |
T |
 |
| Q |
217 |
tttaggatttaggatgggatcattattgctgttgcttgtggttatcatttaagatcactttcgtgggttttggtttccatttgcaatattgttg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37548648 |
tttaggatttaggatgggatcattattgctgttgcttgtggttatcatttaagatcactttcgtgggttttggtttccatttgcaattttgttg |
37548741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 37548433 - 37548484
Alignment:
| Q |
1 |
cgccgctgtcatgcttttcctctttatttccgagctaagtatgatacgatcc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37548433 |
cgccgctgtcatgcttttcctctttatttccgagctaagtatgatacgatcc |
37548484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University