View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_high_28 (Length: 273)
Name: NF1317_high_28
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 10387225 - 10387490
Alignment:
| Q |
1 |
catgtaactcagcagaaagttgcatctgcctaagtttagcggccctctcttcttctgaaagcttaggagccacatttctccgcttatagtgtgattcacg |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10387225 |
catgtaactcagcagcaagttgcatctgcctaagtttagcggccctctcttcttctgaaagcttaggagccacatttctccgcttatagtgtgactcacg |
10387324 |
T |
 |
| Q |
101 |
tccgagtgaattagcggaagatctagtagagcttggttctcgaaagctcccattcccccttttagagacatcaaaattggactgaccttctggagcatat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10387325 |
tccgagtgaattagcagaagatctagtagagcttggttctcgaaagctcccattcccccttttagagacatcaaaattggactgaccttctggagcatat |
10387424 |
T |
 |
| Q |
201 |
cttcctgactttggcttattatcatttctgtcatcaacatcttctttatagtcttttcctttgctt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10387425 |
cttcctgactttggcttattatcatttctgttatcaacatcttctttatagtcttttcctttgctt |
10387490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University