View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1317_high_37 (Length: 214)

Name: NF1317_high_37
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1317_high_37
NF1317_high_37
[»] chr4 (1 HSPs)
chr4 (1-108)||(33887613-33887720)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 33887613 - 33887720
Alignment:
1 gctgcagcaagtcaacagcggagtgtgatcggagcgaaactcgtcagaagccgacgaaagaatattttctgcagcttcagcgagcgagtttggtagttga 100  Q
    |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
33887613 gctgcagcaagtcaacagcggagtgtgatccgagcgaaactcgtcggaagccgacgaaagaatattttctgcagcttcagctagcgagtttggtagttga 33887712  T
101 tgcttcat 108  Q
    ||||||||    
33887713 tgcttcat 33887720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University