View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1317_high_38 (Length: 213)

Name: NF1317_high_38
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1317_high_38
NF1317_high_38
[»] chr4 (1 HSPs)
chr4 (1-89)||(33887555-33887637)


Alignment Details
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 33887637 - 33887555
Alignment:
1 cactccgctgttgacttgctgcagctccggcaaggttactgaaaccgacgacgatgacgttaaggagctcgacactacaccgttagatc 89  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||      ||||||||||||||||||||||||||||||||||    
33887637 cactccgctgttgacttgctgcagctccggcaaggttactgaaaccaac------gacgttaaggagctcgacactacaccgttagatc 33887555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University