View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_18 (Length: 401)
Name: NF1317_low_18
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 96 - 347
Target Start/End: Complemental strand, 31799989 - 31799738
Alignment:
| Q |
96 |
gacccgctttatttcatgtaatatttcgttaatccaatgtttaaaagcttataaaaattgaatgattttaattacctctgatttaatttctacgggaaat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31799989 |
gacccgctttatttcatgtaatatttcgttaatccaatgtttaaaagcttataaaaattgaatgattttaattacctctgatttaatttctacgggaaat |
31799890 |
T |
 |
| Q |
196 |
agagagaattgatgttcacctatcttgtcatgcttactgtgtctgttgcgcaaagttcggctgtcaatcgagcaaagactaggcgcacgtatttgatgat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31799889 |
agagagaattgatgttcacctatcttgtcatgcttactgtgtctgttgcgcaaagttcggctgtcaatcgagcaaagactaggcgcacgtatttgatgat |
31799790 |
T |
 |
| Q |
296 |
tgtttcaatcttttttctatttggtctcacgagttggaaaccaggtaacccc |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31799789 |
tgtttcaatcttttttctatttggtctcacgagttggaaaccaggtaacccc |
31799738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University