View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_21 (Length: 388)
Name: NF1317_low_21
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 100 - 377
Target Start/End: Original strand, 10386950 - 10387227
Alignment:
| Q |
100 |
ctagagacaactgaaataactaaaattaagtgatagaaacaccacaggcagcatttaccgcctaaatgcattgccttcacctccagatctgccttgagaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10386950 |
ctagagacaactgaaataactaaaattaagtgatagaaacaccacaggcagcatttaccgcctaaatgcattgccttcacctccagatctgccttgagaa |
10387049 |
T |
 |
| Q |
200 |
taatgggtccgccgtcggacactctcggctattgaagagctcccgccttctgcagcaccatatatacttttttgagcagtatccaagaaattcttcccac |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10387050 |
taatgggtccgccgtcggacactctcggctattgaagagctcccgccttctgcagcaccatatatacttttttgagcagtatccaagaaattcttcccac |
10387149 |
T |
 |
| Q |
300 |
tagaactagtgttctggattgcttcctgtgcatcagtctcctcagccttctttatacgtttccatctctccccttcat |
377 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10387150 |
tagaactagtgttctggtttgcttcctgtgcatcagtctcctcagccttctttatacgtttccatctctccccttcat |
10387227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University