View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_24 (Length: 375)
Name: NF1317_low_24
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 68 - 310
Target Start/End: Complemental strand, 672165 - 671923
Alignment:
| Q |
68 |
tgaaaatcatggagctgccaattaatttttaatttggccacgaatggatttattttaatattctagttata--gataatagatatacctatctagcaata |
165 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
672165 |
tgaaaatcatgcagctgccaattaatttttaatttggccacgaatggatttattttaatattctagttatatagataatagatatacctatctagcaata |
672066 |
T |
 |
| Q |
166 |
ataatgatattgctaacaaaagtattttgaaattggttatgttcaatgggggttcaataccaacttgtgagtatatatgccgcccacgatgcatgaaaag |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
672065 |
ataatgatattgctaacaaaagtattttgaaattggttatgttcaatggg--ttcaataccaacttgtgagtatatatgccgcccacgatgcatgaaaag |
671968 |
T |
 |
| Q |
266 |
tttcttactttacactccaagcaatttagtgacatttatgaatgc |
310 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
671967 |
tttcttactttaaactctaagcaatttagtgacatttatgaatgc |
671923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University