View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_25 (Length: 371)
Name: NF1317_low_25
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 41 - 283
Target Start/End: Complemental strand, 13624813 - 13624571
Alignment:
| Q |
41 |
atagaaaattttagatccaccattttatgtaatgtgtcatacaagacagttacaacaaaattcttgctaataaattaagtctactttggttaatccatac |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13624813 |
atagaaaattttagatccaccattttatgtaatgtgtcatacaagacagttacaacaaaattcttgctaataaattaagtctactttggttaatccatgc |
13624714 |
T |
|
| Q |
141 |
caaagcaactaagtctctaaacgacaaagtagtgacgatatcagtgcagtgcaggacctctatttagatgaaaataaaagttgtaacgagtggatgatta |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13624713 |
caaagcaactaagtctctaaacgacaaagtagtgacgatatcagtgcagtgcatgacctctatttagatgaaaataaaagttgtaacgagtggatgatta |
13624614 |
T |
|
| Q |
241 |
ttggatacaatggaatacaaatttgtcaattgattgatgatgt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13624613 |
ttggatacaatggaatacaaatttgtcaattgattgatgatgt |
13624571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University