View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_30 (Length: 332)
Name: NF1317_low_30
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 84 - 303
Target Start/End: Original strand, 42956826 - 42957040
Alignment:
| Q |
84 |
atgaagtggattatttccatgtttatcctaatttttaacttcaacagcaacagcctgttttatatgagatatgtatgctacattaagaatagaaacatgt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42956826 |
atgaagtggattatttccatgtttatcctaattttaaacttcaacagcaacagcctgttttatatgagatatatatgctacattaagaatagaaacatgt |
42956925 |
T |
|
| Q |
184 |
atagaaggaagaaacaatagagaaattggaacacttattattatagagattacattagggatgaatataattgtcaccggctcatgcagattgttcaata |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42956926 |
atagaaggaagaaacaatagagaaattggaacacttgttattatagag-----attagggatgaatataattgtcaccggctcatgcagattgttcaata |
42957020 |
T |
|
| Q |
284 |
taattgccatttgttattac |
303 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42957021 |
taattgccatttgttattac |
42957040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University