View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_33 (Length: 326)
Name: NF1317_low_33
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 86 - 229
Target Start/End: Original strand, 50398558 - 50398701
Alignment:
| Q |
86 |
tacttctgtgtttggtaactgcaatcctgaaagtagcaaagttttcaactatggaatttttggaaatgccgtgcaaaataatgttctctcctctatgttt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50398558 |
tacttctgtgtttggtaactgcaatcctgaaagtagcaaagttttcaactatggaatttttggaaatgccgtgcaaaataatgttctctcctctatgttt |
50398657 |
T |
 |
| Q |
186 |
atagagaagtatctctattgtttgtggtgggggttgcagaactt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50398658 |
atagagaagtatctctattgtttgtggtgggggttgcagaactt |
50398701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University