View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_35 (Length: 326)
Name: NF1317_low_35
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 9e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 99 - 229
Target Start/End: Complemental strand, 17319922 - 17319792
Alignment:
| Q |
99 |
aggataagttagtccctctagcaaaagctaaattccatggactgggtgagccaaacaccgcacccaaatcatctttttaagcactcgttcgggttccaac |
198 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17319922 |
aggataagttagtctccctagcaaaagctaaattccatggactgggtgagccaaacaccgcacccaaatcatctttttaagcactcgttcgggttccaac |
17319823 |
T |
|
| Q |
199 |
tccactcatagaagatacaaggagatatatt |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |
|
|
| T |
17319822 |
tccactcatagaagatacagggagatatatt |
17319792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University