View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_40 (Length: 316)
Name: NF1317_low_40
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 163 - 293
Target Start/End: Original strand, 14419931 - 14420061
Alignment:
| Q |
163 |
tgtgggtatggtgagaaatatgatgattgacattaatgtatttcaattcaaaattgattttattattgtacaagataaaggagagcaagagtgcccgctt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14419931 |
tgtgggtatggtgagaaatatgatgattgacattaatgtatttcaattcaaaattgattttattgttgtacaagataaaggagagcaagagtgcccgctt |
14420030 |
T |
|
| Q |
263 |
attttaagaagatcatctatggcaacagcta |
293 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
14420031 |
attttaagaagatcatctatggcaactgcta |
14420061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 54 - 156
Target Start/End: Original strand, 41727203 - 41727305
Alignment:
| Q |
54 |
attttcggcattatggaggaggcattgcgtgaaggaaaactacatccatactacaacaacatgtttaggaggatccagaaggaaatgcacccagtgaacg |
153 |
Q |
| |
|
|||| |||||||||||||||||| ||| ||||||| ||| ||||||||||||| ||| ||||||||| ||||||||| |||| ||||| ||| ||||| |
|
|
| T |
41727203 |
atttacggcattatggaggaggcgttgtgtgaaggcgaaccacatccatactaccacatcatgtttagaaggatccaggaggagatgcatccatggaacg |
41727302 |
T |
|
| Q |
154 |
agc |
156 |
Q |
| |
|
||| |
|
|
| T |
41727303 |
agc |
41727305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 167 - 252
Target Start/End: Complemental strand, 15577778 - 15577693
Alignment:
| Q |
167 |
ggtatggtgagaaatatgatgattgacattaatgtatttcaattcaaaattgattttattattgtacaagataaaggagagcaaga |
252 |
Q |
| |
|
||||||||||||||||||||| |||| ||| ||| |||| |||| |||| ||| ||||| ||| ||| |||||| |||||||||| |
|
|
| T |
15577778 |
ggtatggtgagaaatatgatggttgatattgatggattttaatttgaaatcgatgttattgttgcacaggataaaagagagcaaga |
15577693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University