View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_48 (Length: 293)
Name: NF1317_low_48
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 52 - 222
Target Start/End: Complemental strand, 1214190 - 1214020
Alignment:
| Q |
52 |
ctagctgttgcttactcggtatatatactcttctttatttaaatcaacagttgaaaattctatataaatttcatgtatgaattgataatattgatttgat |
151 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1214190 |
ctagccgttgcttactcggtatatatactcttctttatttaaatcaacagttgaaaattctatataaatttcatgtatgaattgataatattgatttgat |
1214091 |
T |
|
| Q |
152 |
gtttgattttaatattgtagggggttgttgcctcaggattagtggttattgtgacttcgtggtgcataaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1214090 |
gtttgattttaatattgtagggggttgttgcctctggattagtggttattgtgacttcgtggtgcataaag |
1214020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University