View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_53 (Length: 275)
Name: NF1317_low_53
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 96 - 267
Target Start/End: Original strand, 45166411 - 45166582
Alignment:
| Q |
96 |
cacccattactttgtttttaaactaaacccttacactaaggcagaaataattgtcatgtttcaaccatgcaggtgatatggccaatcgagatgaagtgct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45166411 |
cacccattactttgtttttaaactaaacccttacactaaggcagaaataattgtcatgtttcaaccatgcaggtgatatggccaatcgagatgaagtgct |
45166510 |
T |
|
| Q |
196 |
taattgataagatgtacatgttgtaacacttatcttcaaactcttcatgtttgtgggattgttgcctatgct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45166511 |
taattgataagatgtacatgttgtaacacttatcttcaaactcttcatgtttgtgggattgttgcctatgct |
45166582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 45166277 - 45166389
Alignment:
| Q |
1 |
tcatcatattcatgtttttgacatcaaacatgattggcaatttgatgggaaaagtgctctcatgttgcaatatcctccttcttaaatgcatatttcaccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45166277 |
tcatcatattcatgtttttgacatcaaacatgattggcaatttgatgggaaaaatgctctcatgttgcaatatcctcctccttaaatgcatatttcaccc |
45166376 |
T |
|
| Q |
101 |
attactttgtttt |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45166377 |
attactttgtttt |
45166389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University