View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_72 (Length: 221)
Name: NF1317_low_72
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_72 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 75
Target Start/End: Original strand, 33780052 - 33780095
Alignment:
| Q |
33 |
caaacatacaattaa-ctatatagcacatgttgcacggcctttg |
75 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33780052 |
caaacatacaattaaactatatagcacatgttgcacggcctttg |
33780095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University