View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_73 (Length: 217)
Name: NF1317_low_73
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 50027269 - 50027404
Alignment:
| Q |
1 |
agggttacctgaatttgaaagaactctagtatctagaggtgaagttggacttctaactgaatcagaatccaacaacccttttggacctaaacccacaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50027269 |
agggttacctgaatttgaaagaactctagtatctagaggtgaagttggacttctaactgaatcagaatccaacaacccttttggacctaaacccacaaac |
50027368 |
T |
|
| Q |
101 |
aaacaaggaacattgaaaattggattgcctatgata |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50027369 |
aaacaaggaacattgaaaattggattgcctttgata |
50027404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University