View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1317_low_78 (Length: 209)
Name: NF1317_low_78
Description: NF1317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1317_low_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 4e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 9 - 101
Target Start/End: Original strand, 4165824 - 4165916
Alignment:
| Q |
9 |
gatgataaccgtgctgagcccttttcgtcatttaacagcttgaaaagtttgatcattcactgttgtgttgaagaacaaaacctgttcatatca |
101 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4165824 |
gatgatgaccgtgctgagcccttttcgtcatttaacagcttgaaaagtttgatcattcactgttgtgttgaagaacaaaacctgttcatatca |
4165916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 9 - 101
Target Start/End: Original strand, 4150052 - 4150144
Alignment:
| Q |
9 |
gatgataaccgtgctgagcccttttcgtcatttaacagcttgaaaagtttgatcattcactgttgtgttgaagaacaaaacctgttcatatca |
101 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4150052 |
gatgatgaccgtgctgagcccttttcgtcatttaacagcttgaaaagtttgatcattcactgttgtgttcaagaacaaaacctgttcatatca |
4150144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University