View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13180_low_20 (Length: 257)
Name: NF13180_low_20
Description: NF13180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13180_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 4405885 - 4406130
Alignment:
| Q |
1 |
ttattgtttatctataaaatcttcttttccactgtatgaacagtggtatagacttcatttttaacgaaatacaatggtatagaaaattgtcacacaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405885 |
ttattgtttatctataaaatcttcttttccactgtatgaacagtggtatagatttcatttttaacgaaatacaatggtatagaaaattgtcacacaaaac |
4405984 |
T |
|
| Q |
101 |
aacaagtagaaagtaaatcattattcttaaagggcttccatcattcac-aaaaaatataatacaaattaatcattgatattttcataccttcaaattgtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405985 |
aacaagtagaaagtaaatcattattcttaaagggcttccatcattcacaaaaaaatataatacaaattaatcattgatattttcataccttcaaattgtg |
4406084 |
T |
|
| Q |
200 |
tttgtaattcatcaaaccagtggtggtgaggtctcatgcaaatatt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4406085 |
tttgtaattcatcaaaccagtggtggtgaggtctcatgcaaatatt |
4406130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University