View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13180_low_21 (Length: 255)
Name: NF13180_low_21
Description: NF13180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13180_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 4405900 - 4405662
Alignment:
| Q |
1 |
tatagataaacaataaatgaaaccacatgatttagtcnnnnnnnntaaa--tgaaaccacatgtgtatgtataaacatttcatcataattttggttacag |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405900 |
tatagataaacaataaatgaaaccacatgatttagtcaaaaaaaaaaaaaatgaaaccacatgtgtatgtataaacatttcatcataattttggttacag |
4405801 |
T |
 |
| Q |
99 |
aacaggttcactcctttttcagaaagattgagggaaattattgttttccctcttaaagcaaacgttttcgggtgttttggtcaagttaactggttggatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4405800 |
aacaggttcactcctttttcagaaagattgagggaaattattgttttccctc-taaagcaaacgttttcgggtgttttggtcaagttaactggttggatg |
4405702 |
T |
 |
| Q |
199 |
ataatgaagtcatactatatagaacaagacaaggaaaagt |
238 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
4405701 |
ataatgaagtcatgctatgtagaacaagacaaggaaaagt |
4405662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University