View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13180_low_25 (Length: 248)
Name: NF13180_low_25
Description: NF13180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13180_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 23904459 - 23904230
Alignment:
| Q |
1 |
ttgtttttgctatcacgtttcttcggacgaacctttccttcattagatgaaggtagttgctcattctgcaaaggttcacggtccacattaagcaaagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23904459 |
ttgtttttgctatcacgtttcttcggacgaacctttccttcattagatgaaggtggttgctcattctgcaaaggttcacggtccacattaagcaaagctt |
23904360 |
T |
|
| Q |
101 |
tatcaaacatttctgataattcatcctcatcaacaacactaatagccgattgcttgttactactcccttcttcttcttcgcgcctgtgattctttctact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23904359 |
tatcaaacatttctgataattcatcctcatcaacaacactaatagccgattgcttgttactactcccttcttcttcttcgcgcccgtgattctttctact |
23904260 |
T |
|
| Q |
201 |
cttcatcatattgaaattggaaggttctaa |
230 |
Q |
| |
|
||||||||||||||||||||| | |||||| |
|
|
| T |
23904259 |
cttcatcatattgaaattggatgattctaa |
23904230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 23922525 - 23922754
Alignment:
| Q |
1 |
ttgtttttgctatcacgtttcttcggacgaacctttccttcattagatgaaggtagttgctcattctgcaaaggttcacggtccacattaagcaaagctt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
23922525 |
ttgtttttgctatcacgtttcttgggacgaacctttccttcgttagatgaaggtggttgctcattctgcaaaaattcacgttccacgttaagcaaagctt |
23922624 |
T |
|
| Q |
101 |
tatcaaacatttctgataattcatcctcatcaacaacactaatagccgattgcttgttactactcccttcttcttcttcgcgcctgtgattctttctact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23922625 |
tatcaaacatttctgataattcatcctcatcaacaacactaatagccgattgcttgttactactcccttcttcttcttcgcgcccgtgattctttctact |
23922724 |
T |
|
| Q |
201 |
cttcatcatattgaaattggaaggttctaa |
230 |
Q |
| |
|
||||||||||||||||||||| | |||||| |
|
|
| T |
23922725 |
cttcatcatattgaaattggatgattctaa |
23922754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 83 - 178
Target Start/End: Original strand, 23912628 - 23912726
Alignment:
| Q |
83 |
ccacattaagcaaagctttatcaaacatttctgataattcatcctcatcaacaacactaatagccgattgcttgttactactcc---cttcttcttctt |
178 |
Q |
| |
|
|||||||||||||| | ||||||||||| |||||||||||||||||||||||| |||||||||| ||||||||| |||| |||| |||||||||||| |
|
|
| T |
23912628 |
ccacattaagcaaaaccttatcaaacatctctgataattcatcctcatcaacagcactaatagctgattgcttgctacttctccaagcttcttcttctt |
23912726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University