View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13180_low_26 (Length: 247)
Name: NF13180_low_26
Description: NF13180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13180_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 5 - 229
Target Start/End: Complemental strand, 45382208 - 45381994
Alignment:
| Q |
5 |
aacaattatgtataattatgcaaggtaggggctagaagcatctcatggatgtgtttaccatttgttatatctctgtacttgaacttgaatacgagtaaca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45382208 |
aacaattatgtataattatgcaaggtaggggct----------catggatgtgtttaccatttgttatatctctgtacttgaacttgaatacgagtaaca |
45382119 |
T |
|
| Q |
105 |
acccaaatgagtttccttaggctcatctcgcgggtagctccaaatccatctcctcctatcccagaacttgtaacatgatttagagcagtttcctaaaaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45382118 |
acccaaatgagtttccttaggctcatctcgcgggtagctccaaatccatctcctcctatcccagaacttgtaacatgatttagagcagtttcctaaaaaa |
45382019 |
T |
|
| Q |
205 |
tattttccatttctttagttcatac |
229 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45382018 |
tattttccatttctttagttcatac |
45381994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University