View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13180_low_30 (Length: 219)
Name: NF13180_low_30
Description: NF13180
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13180_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 23 - 200
Target Start/End: Complemental strand, 6035617 - 6035440
Alignment:
| Q |
23 |
gtacccaaaacctaactaatatttctgttttgttttaagggatcatcacatgcccaacttaattgttttgcatgaaaatggaaaacatagaattcatggg |
122 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6035617 |
gtacccaaaacctaactactatttctgttttgttttaagggatcatcacatgcccaacttaattgttttgcatgaaaatggaaaacatagaattcatggg |
6035518 |
T |
 |
| Q |
123 |
agaaagatgtttggttgcatgctccacaagaaaatgcacttcctgtaaaattannnnnnnnccctattttatttgttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||| |
|
|
| T |
6035517 |
agaaagatgtttggttgcatgctccacaagaaaatgtacttcctgtcaaattattttttttccctattttatttgttc |
6035440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University