View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13181_high_22 (Length: 357)
Name: NF13181_high_22
Description: NF13181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13181_high_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 8287298 - 8287205
Alignment:
| Q |
8 |
ccaagaatatcaccatccttctccccttcgttctttgtcttcaatggcttctgattcacctttccctgttaccgctcaaaatattaaccctcag |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8287298 |
ccaacaatatcaccatccttctccccttcgttctttgtcttcaatggcttctgattcacctttccctgttaccgctcaaaatattaaccctcag |
8287205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University