View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13181_high_31 (Length: 286)
Name: NF13181_high_31
Description: NF13181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13181_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 162 - 274
Target Start/End: Original strand, 25981036 - 25981148
Alignment:
| Q |
162 |
gaaaatggaaaaagaggaacatggcggatcattgatggattgggagggaacatgaccggaatacattccaaaaagagacgtcatctcaaatgttctttcc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
25981036 |
gaaaatggaaaaagaggaacatggcggatcattgatggattgggagggaacatgaccggaatacattccaaaaagagacgtcatctcaaatggtccttcc |
25981135 |
T |
 |
| Q |
262 |
atgggggtaactg |
274 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
25981136 |
atggggataactg |
25981148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University