View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13181_high_43 (Length: 227)
Name: NF13181_high_43
Description: NF13181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13181_high_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 7 - 154
Target Start/End: Complemental strand, 25966078 - 25965931
Alignment:
| Q |
7 |
acatgaattatattatatactatcttatattttgccccaaaagatactatttaagatacattatctggcttaatatagtagctannnnnnngagcttaat |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
25966078 |
acatgaattatattatatactatcttatatttttccctaaaagatactatttaagatacattatctggcttaatatagtagctatttttttgtgcttaat |
25965979 |
T |
 |
| Q |
107 |
aaatagttatctaatagtttcaccaaaagaaattgttatctattagta |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25965978 |
aaatagttatctaatagtttcaccaaaagaaattgttatctattagta |
25965931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 187 - 227
Target Start/End: Complemental strand, 25965898 - 25965858
Alignment:
| Q |
187 |
ctataatttcaagtgagattcacattgtcaatgatagagaa |
227 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25965898 |
ctataattttaagtgagattcacattgtcaatgatagagaa |
25965858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University