View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13181_low_21 (Length: 382)
Name: NF13181_low_21
Description: NF13181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13181_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 4e-91; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 37387666 - 37387879
Alignment:
| Q |
18 |
tttcccaacccatgaattccacccaaagacactcaatctcaagattttctaaagtcccctccttcgattttacaagattgctcataaaatgtcgaactga |
117 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
37387666 |
tttcccaacccaagaattccacccaaagacactcaatctcaaggttttctaaagtcccctcctttgattttacaggattgctcataaaatgttgaactga |
37387765 |
T |
|
| Q |
118 |
agcttatacgttgtccatattgagacgaaatcgcgttacgatttgtctgaatcactactcgatttgcaattcgtacattgtactattggtagcagtaggt |
217 |
Q |
| |
|
|| ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37387766 |
agtttatacgttgtccatattgagacaaaatcgcgttacgatttgtctaaatcactactcgatttgcaattcgtacattgtactattggtagcagtaggc |
37387865 |
T |
|
| Q |
218 |
aaaattgtgccaca |
231 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
37387866 |
aaaaccgtgccaca |
37387879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 313 - 367
Target Start/End: Original strand, 37387919 - 37387973
Alignment:
| Q |
313 |
aatcgtgccacaattttttagtaacttcatcaccaaattttgagactattttcaa |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37387919 |
aatcgtgccacaattttttagtaacttcatcaccaaattttgagattattttcaa |
37387973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 245 - 298
Target Start/End: Original strand, 37387872 - 37387925
Alignment:
| Q |
245 |
gtgccacagtttttgacaaaccaaaaacatgaaaaacaatgacatctaatcgtg |
298 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37387872 |
gtgccacagtttttgacgaaccaaaaacatgaaaaacaacgacatctaatcgtg |
37387925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University