View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13181_low_24 (Length: 357)

Name: NF13181_low_24
Description: NF13181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13181_low_24
NF13181_low_24
[»] chr8 (1 HSPs)
chr8 (8-101)||(8287205-8287298)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 8 - 101
Target Start/End: Complemental strand, 8287298 - 8287205
Alignment:
8 ccaagaatatcaccatccttctccccttcgttctttgtcttcaatggcttctgattcacctttccctgttaccgctcaaaatattaaccctcag 101  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8287298 ccaacaatatcaccatccttctccccttcgttctttgtcttcaatggcttctgattcacctttccctgttaccgctcaaaatattaaccctcag 8287205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University