View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13181_low_46 (Length: 234)
Name: NF13181_low_46
Description: NF13181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13181_low_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 11 - 131
Target Start/End: Complemental strand, 1663844 - 1663724
Alignment:
| Q |
11 |
catcatcaacaccacgatgaacagtaccaaaagtaccacgagcaatgacagttttgataataagtttagaaggatcaatctcccattcttgtctatttct |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1663844 |
catcataaacaccacgatgaacagtaccaaaagtaccacgagcaatgacagttttgataataagtttagaaggatcaatctcccattcttgtctatttct |
1663745 |
T |
 |
| Q |
111 |
tgtattactattagaagaaga |
131 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1663744 |
tgtattactattagaagaaga |
1663724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 185 - 215
Target Start/End: Complemental strand, 1663670 - 1663640
Alignment:
| Q |
185 |
ccatagtccatgctctactaagatgcctttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1663670 |
ccatagtccatgctctactaagatgcctttg |
1663640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 95
Target Start/End: Complemental strand, 43970907 - 43970824
Alignment:
| Q |
12 |
atcatcaacaccacgatgaacagtaccaaaagtaccacgagcaatgacagttttgataataagtttagaaggatcaatctccca |
95 |
Q |
| |
|
||||| |||||||||||||||||| |||||||| ||||||||||| ||| ||||||| || ||||||||||||||||| ||||| |
|
|
| T |
43970907 |
atcataaacaccacgatgaacagtgccaaaagtgccacgagcaataacacttttgatgatgagtttagaaggatcaatttccca |
43970824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 100
Target Start/End: Complemental strand, 35189534 - 35189455
Alignment:
| Q |
21 |
accacgatgaacagtaccaaaagtaccacgagcaatgacagttttgataataagtttagaaggatcaatctcccattctt |
100 |
Q |
| |
|
|||||| ||||||||||| ||||| |||||||| | |||| | ||||| || || |||||||||||||| ||||| |||| |
|
|
| T |
35189534 |
accacggtgaacagtaccgaaagtgccacgagctaagacactcttgatgatgaggttagaaggatcaatttcccactctt |
35189455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University