View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13181_low_48 (Length: 234)
Name: NF13181_low_48
Description: NF13181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13181_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 4526176 - 4525967
Alignment:
| Q |
1 |
gcttgagtgaaggtttttaatatgtaagacctttaatttggttgaattttagtcctagttgttataacnnnnnnnnnnn-attgaaatattgatttgatg |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
4526176 |
gcttgagtgaaggtttttaatatttaagacctttaatttggttgaattttagttctagttgttataacttttttttttttattgaaatattgatttgatg |
4526077 |
T |
|
| Q |
100 |
ttactcttattttatctatgatgagcaatgatcaataagacaacatcgatgatgagcaatttgttctatagctaagacaacttgattttcactaccttac |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
4526076 |
ttactcttattttatctatgatgagcaatgatcaataagacaacatcgatgatgatcaatttgtgc--tagctaagacaacttgattttcactaccttac |
4525979 |
T |
|
| Q |
200 |
aggggaagtgtt |
211 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4525978 |
aggggaagtgtt |
4525967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University