View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13181_low_49 (Length: 232)
Name: NF13181_low_49
Description: NF13181
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13181_low_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 10767385 - 10767168
Alignment:
| Q |
1 |
atggcattccaagtttagcacgtgcaagtcttacaactatttcatggatgtgtagctaccttcacttagttgaagatacaaagttgccacaaatggcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10767385 |
atggcattccaagtttagcacgtgcaagtcttacaactatttcatggatgtgtagctaccttcacttagttgaagatacaaagttgccacaaatggcttt |
10767286 |
T |
 |
| Q |
101 |
ctcaatcttaacaccacagttgctacaatcattgaattatgataatgatgttgaagaaagagttctatcttcatattcattgttgtatcttacaaaatat |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10767285 |
ctcaatcttaacaccacagttactacaatcattgaattatgataatgatgttgaagaaagagttctatcttcatattcattgttgtatcttacaaaatat |
10767186 |
T |
 |
| Q |
201 |
tcaggtacatatattctt |
218 |
Q |
| |
|
|| ||||||||| ||||| |
|
|
| T |
10767185 |
tctggtacatattttctt |
10767168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University