View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13182_low_14 (Length: 270)
Name: NF13182_low_14
Description: NF13182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13182_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 13447669 - 13447418
Alignment:
| Q |
1 |
atcctgtaaagctggtttctgtactttaaatctctagattttgtgggatcctgtcnnnnnnnnnnnnnnnngaccgaagattagcccctaatttgtttca |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13447669 |
atcctgtaaagctggttcctgtactttaaatctctagattttgtgggatcctgtctgtttctttttcttttgaccgaagattagcccctaatttgtttca |
13447570 |
T |
 |
| Q |
101 |
ttcgctatacataccaagtttggttcgaatgcatttctttcatgtctggttttcaatcatctacaatctgtgcaccaacactgttgtatt-ttttcgatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13447569 |
ttcgctatacataccaagtttggttcgaatgcatttctttcatgtctggttttcaatcatctacaatctgtgcaccaacactgttgtatttttttcgatg |
13447470 |
T |
 |
| Q |
200 |
gatctcttgtcgtgttggtgatccattggtgtcgtcgttgaggcgtctgtcg |
251 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13447469 |
gatctcttgtcgtgttgatgatccattggtgtcgtcgttgaggcgtctgtcg |
13447418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University