View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13182_low_17 (Length: 238)
Name: NF13182_low_17
Description: NF13182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13182_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 47 - 235
Target Start/End: Complemental strand, 36943848 - 36943652
Alignment:
| Q |
47 |
tagaaggcgatccaaaaatcacgccggatatccttc---------aacggaatttcactctatccttttgaaattctacctgtaaatggacgtatgcaca |
137 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36943848 |
tagaaggcgatccaaaaatcacgccagatatccttcgacgaactcaacggaatttcactccatccttttgaaattctacctgtaaatggacgtatgcaca |
36943749 |
T |
|
| Q |
138 |
tgagaaagataataacacttttatccaaaaaatctcacacgtgcctcaatcacaaaattacctcaacgttgaagtgtttgcaaatagaacaactctga |
235 |
Q |
| |
|
|||||||| || ||||||||||||||| |||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36943748 |
tgagaaaggtagtaacacttttatcca-aaaatctcacacgtgcctcattcacaaaattagctcagcgttgaagtgtttgcaaatagaacaactctga |
36943652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University