View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13182_low_19 (Length: 220)
Name: NF13182_low_19
Description: NF13182
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13182_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 50419267 - 50419453
Alignment:
| Q |
19 |
aatatgactatcattaactacacccctctgttcttcctctgcctcataaccccccttgcacttagcaatgttgaaatacattcaggtacaaaaagataat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50419267 |
aatatgactatcattaactacacccctctgttcttcctctgcttcataaccccccttgcacttagcaatgttgaaatacattcaggtacaaaaagataat |
50419366 |
T |
|
| Q |
119 |
aacatttcactcttttttgaagtattttcatataattcttgcttgaaacttatgtttatcattgtgttagcaggcccttcaacacag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50419367 |
aacatttcactcttttttgaagtattttcatataattcttgcttgaaacttatgtttatcattgtgttagcaggcccttcaacacag |
50419453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University