View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13183_high_13 (Length: 311)

Name: NF13183_high_13
Description: NF13183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13183_high_13
NF13183_high_13
[»] chr3 (1 HSPs)
chr3 (1-41)||(13206390-13206430)


Alignment Details
Target: chr3 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 13206430 - 13206390
Alignment:
1 acttgaccccgaaaaaataaaacaactagtgtgatctttta 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
13206430 acttgaccccgaaaaaataaaacaactagtgtgatctttta 13206390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University