View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13184_high_7 (Length: 271)
Name: NF13184_high_7
Description: NF13184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13184_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 7 - 256
Target Start/End: Complemental strand, 38866444 - 38866195
Alignment:
| Q |
7 |
gagagaagaaacattgcttagagaagaaggtattgttccagtcaagaggttgttaacgagagagattgtttggagttgttggaagttgctgaaggtttgt |
106 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38866444 |
gagagaagaaacattgcttagagaggaaggtattgttccagtaaagaggttgttaacgagagagattgtttggagttgttggaagttgctgaaggtttgt |
38866345 |
T |
 |
| Q |
107 |
gggatgttgccggagaagttgttgaaggagaggttgagttcttggagagggaggtcggagagagtgtgagggatattgccggcgaagaggttgagggaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38866344 |
gggatgttgccggagaagttgttgaaggagaggttgagttcttggagagggaggtcggagagagtgtgagggatattgccggcgaagaggttgagggaga |
38866245 |
T |
 |
| Q |
207 |
gatcaagatggcggagagtggtgcaagtggagatggtagtggggagagtg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38866244 |
gatcaagatggcggagagtggtgcaagtggagatggtagtggggagagtg |
38866195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University