View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13185_high_5 (Length: 227)
Name: NF13185_high_5
Description: NF13185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13185_high_5 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 77 - 227
Target Start/End: Original strand, 17175468 - 17175618
Alignment:
| Q |
77 |
tcaagagatctaaggaaataaagaatggaagtccgtgactatctctnnnnnnnncatccctaagaaacaagggtaaataatccccccaaatattaatcaa |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17175468 |
tcaagagatctaaggaaataaagaatggaagtccgtgactatctctaaaaaaaacatccctaagaaacaagggtaaataatccccccaaatattaatcaa |
17175567 |
T |
 |
| Q |
177 |
aaacacttatggataaaacttatgtgcactggtatagacatcgtcactttt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17175568 |
aaacacttatggataaaacttatgtgcactggtatagacatcgtcattttt |
17175618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University