View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13186_low_16 (Length: 335)
Name: NF13186_low_16
Description: NF13186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13186_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 181 - 288
Target Start/End: Original strand, 29248366 - 29248473
Alignment:
| Q |
181 |
gaggtgaaggaggaggggaagaggaagtatattgaacttattcatgagctaggattcaagagaaagtattctgtaagtactaagtatctatggacattac |
280 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| || |
|
|
| T |
29248366 |
gaggtggaggaggaggggaagaggaagtatattgaacttattcatgagctaggattcaagagaaaatattctgtaagtactaagtatatatggacatcac |
29248465 |
T |
 |
| Q |
281 |
cattttca |
288 |
Q |
| |
|
||||||| |
|
|
| T |
29248466 |
tattttca |
29248473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 29248310 - 29248353
Alignment:
| Q |
64 |
aggaagtgcatgtgaacctcccccattccc--gagtttaatgat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29248310 |
aggaagtgcatgtgaacctcccccattcccctgagtttaatgat |
29248353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University