View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13187_high_18 (Length: 271)
Name: NF13187_high_18
Description: NF13187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13187_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 47000514 - 47000768
Alignment:
| Q |
1 |
atggaaacaagctggtttcctgaacctttctacaccatccatcatataccattttttaaaatattacttggatttattatgcatgcaattctgttacagg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47000514 |
atggacacaagctggtttcctgaacctttctacaccatccatcatataccattttttaaaatattacttggatttattatgcatgcaattctgttacagg |
47000613 |
T |
 |
| Q |
101 |
atcatatgccaaattcatctctttgttggatacttgctgatatggattcagagacgcttgaacttcttctagtgtgcgccccttggtctcgggtactagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47000614 |
atcatatgccaaattcatctctttgttggatacttgctgatatggattcagagacgcttgaacttcttctagtgtgcgccccttggtctcgggtactagt |
47000713 |
T |
 |
| Q |
201 |
tttgctacaaatagaatggtgaggccacagatggtaaagaatatgaagaaagttc |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47000714 |
tttgctacaaatagaatggtgaggccacagatggtagagaatatgaagaaagttc |
47000768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 157 - 234
Target Start/End: Original strand, 47005781 - 47005858
Alignment:
| Q |
157 |
cttgaacttcttctagtgtgcgccccttggtctcgggtactagttttgctacaaatagaatggtgaggccacagatgg |
234 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||| || || ||||||||||| |||| || |||| |||||| |||| |
|
|
| T |
47005781 |
cttgaatttcttctagcgtgcgccccttggtctcaggaaccagttttgctacgaataaaacagtgaagccacatatgg |
47005858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University