View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13187_low_16 (Length: 348)
Name: NF13187_low_16
Description: NF13187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13187_low_16 |
 |  |
|
| [»] scaffold0057 (4 HSPs) |
 |  |  |
|
| [»] scaffold0258 (2 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
| [»] scaffold0867 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 73)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 343
Target Start/End: Complemental strand, 18512714 - 18512374
Alignment:
| Q |
1 |
tttaagaagtgtagtcattgccaaatgaaaaggcaaaaccaacctagtttgcaaaggatgcaacctgtcgnnnnnnngagaaagactgctgaatcatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18512714 |
tttaagaagtgtagtcattgccaaatgaaaaggcaacaccaacctagtttgcaaaggatgcaacctgtcgaaaaaaagagaaagactgctgaatcatttc |
18512615 |
T |
 |
| Q |
101 |
atgattatagattgcgatgatagttggaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18512614 |
gtgattatagattgcgatgatagttggaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccga |
18512515 |
T |
 |
| Q |
201 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccctgnnnnnnnnnnnnnnnagattgcgatgatattgattctac |
300 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18512514 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttggtgcactgggttgccctg--ttattttttttttagattgcgatgatattgattctac |
18512417 |
T |
 |
| Q |
301 |
atctgttggtatagaagcagaggcgtataggttttcaatgttt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18512416 |
atctgttggtatagaagcagaggcgtataggttttcaatgttt |
18512374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 21172143 - 21172011
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
21172143 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
21172045 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
21172044 |
catatgcgggagctctagtgcaccgggttgccct |
21172011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 42391234 - 42391102
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
42391234 |
gaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
42391136 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
42391135 |
catatgcgggagctctagtgcaccgggttgccct |
42391102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 125 - 260
Target Start/End: Complemental strand, 2541157 - 2541021
Alignment:
| Q |
125 |
tggaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||| ||||||| |||||||||||||||| |||| || |
|
|
| T |
2541157 |
tggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtactatacaccaaatggtgggaccccttcccggtcc |
2541058 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
2541057 |
ctgcgtatgcgggagctttagtgcaccgggtttccct |
2541021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 7879639 - 7879771
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||| | ||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
7879639 |
aaggtcacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
7879738 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
7879739 |
gtatgcgggagcttcagtgcaccgggttgccct |
7879771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 10693207 - 10693075
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
10693207 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaag-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
10693109 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | |||||| |||||||||| |
|
|
| T |
10693108 |
catatgcgggagctctagtgcactgggttgccct |
10693075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 127 - 258
Target Start/End: Complemental strand, 33872045 - 33871914
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| ||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||| || ||||||| |
|
|
| T |
33872045 |
gaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcccagaccctg |
33871946 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||| ||||||| ||||||| ||||||| |
|
|
| T |
33871945 |
tgtatgcgagagctttagtgcaccaggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 47716460 - 47716594
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
47716460 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
47716559 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||| |
|
|
| T |
47716560 |
gcatatgcgggagctttggtgcaccgggttgccct |
47716594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 11617724 - 11617590
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||||||||| |||||||| |||||||||||||||| |||||||||||||||| | ||||||| |
|
|
| T |
11617724 |
gaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctggaccct |
11617625 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
11617624 |
gcgtatgcaggacctttagtgcaccgggttgccct |
11617590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 48735257 - 48735124
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcct-gaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| |||||||||||| | ||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
48735257 |
gaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaac-acggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
48735159 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||| | ||||||||||||||||| |
|
|
| T |
48735158 |
gcatatgcgggagctctagtgcaccgggttgccct |
48735124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 32758260 - 32758392
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | |||||||||||| |||||||||||| |||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
32758260 |
gaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctg |
32758358 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
32758359 |
catatgcgggagctctagtgcaccgggttgccct |
32758392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 42805525 - 42805659
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| |||||||||||| |||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
42805525 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggacccc |
42805624 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||| |
|
|
| T |
42805625 |
gcatatgcgggagctttagtgcaccgggttgccct |
42805659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 19427025 - 19426892
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| ||||||||| |||||||||||||||| |||||||||| ||||| |||||||| |
|
|
| T |
19427025 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacaccaaatggtggga-cccttctcggaccct |
19426927 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||| |||||| ||||||||||||||||| |
|
|
| T |
19426926 |
gcatatgcgagagcttcagtgcaccgggttgccct |
19426892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 27629633 - 27629767
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| ||||||||| |||||| |||||||| |||||||||||||||| |||| |||| |
|
|
| T |
27629633 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtaaaatacaccaaatggtgggaccccttcccgggccct |
27629732 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
27629733 |
gcatatgcggtagcttcagtgcaccgggttgccct |
27629767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 11741794 - 11741926
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||| | ||| |||||||| |||||||||||||||||||||||||| |||||||||| ||||| ||||| ||| |
|
|
| T |
11741794 |
gaaaggtcatgggttcaagtcctgaaaacagcttctagtgtaaaa-tagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccggattctg |
11741892 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||||||||| | ||||||||||||||||| |
|
|
| T |
11741893 |
cacatgcgggagctctagtgcaccgggttgccct |
11741926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 31591243 - 31591111
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||||||||| || |||||||||||||||||||| |||||||||||||||| ||||||| || |
|
|
| T |
31591243 |
gaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaac-agagtaaggctgcgtacaatacaataaatggtgggaccccttcccggaccttg |
31591145 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
31591144 |
catatgcgggagctctagtgcaccgggttgccct |
31591111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 34626343 - 34626210
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||| ||| | ||||||||||| ||||| | || |||||||||| ||||||||||||||| ||||||||| |||||||||| ||||| |||||||||| |
|
|
| T |
34626343 |
gaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaacagggtaaggctgcgttcaatacaccaaatggtgggatcccttcccggaccctg |
34626244 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| || || ||||||||||| |
|
|
| T |
34626243 |
cgtatgcgggagctttagttcatcgggttgccct |
34626210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 40463878 - 40464009
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
||||||||||||||||||| | ||||| ||||||||||||| ||||||||||||||| |||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
40463878 |
aaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaactgggtaaggctgcgtataatacaccaaatggtgggaccccttctcggaccctgcg |
40463977 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| |||||||| |||||||| |
|
|
| T |
40463978 |
tatgcgggagcttcagtgcaccgagttgccct |
40464009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 19265814 - 19265946
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||||||| || | ||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||| ||| |
|
|
| T |
19265814 |
gaaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaagagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-ccta |
19265912 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||| ||||||||| |||||||||| |||||| |
|
|
| T |
19265913 |
catatgtgggagctttagtgcaccgggctgccct |
19265946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 179 - 260
Target Start/End: Complemental strand, 27889399 - 27889318
Alignment:
| Q |
179 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27889399 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccct |
27889318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 35334948 - 35334818
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||| ||||||||| |||||||| ||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35334948 |
aaggtcacgagttcaagtcctggaaacag--tctcgtgtaaaaaacagggtaagactgtgtacaatacaccgaatggtgggaccccttcccggaccctgc |
35334851 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||| |
|
|
| T |
35334850 |
gtatgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 29907418 - 29907551
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||||| |||||||| |||||||||||| ||||||||| |||||||||||||| | |||||||| |
|
|
| T |
29907418 |
gaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaaaatggtgggaccccatcccggaccc |
29907517 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
29907518 |
t--gtatgcgggagctttagtgcaccgggttgccct |
29907551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 147 - 254
Target Start/End: Original strand, 38604546 - 38604654
Alignment:
| Q |
147 |
cctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt-ggt |
245 |
Q |
| |
|
|||| ||||| | ||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||| || |
|
|
| T |
38604546 |
cctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagt |
38604645 |
T |
 |
| Q |
246 |
gcaccgggt |
254 |
Q |
| |
|
||||||||| |
|
|
| T |
38604646 |
gcaccgggt |
38604654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 42798670 - 42798802
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||| | ||||||||||||||||||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
42798670 |
aaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgc |
42798769 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||| | ||||| ||||||||||| |
|
|
| T |
42798770 |
atatgcgggagctatagtgcatcgggttgccct |
42798802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 43557471 - 43557608
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||| |||||||||||||| ||||| | ||||||||||||| || |||||||||||||||||||||| | ||||||||||||| | |||||| |
|
|
| T |
43557471 |
gaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggact |
43557570 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagc-tttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
43557571 |
ctgcgtatgcgggagcttttagtgcaccgggttgccct |
43557608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 18747485 - 18747620
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat--agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||||| ||||||| || ||||| | | ||||||||||| |||||||||||||||| |||||||| | |||||||||||||| | | |||| |
|
|
| T |
18747485 |
gaaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggaccccttcctgaaccc |
18747584 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||| |
|
|
| T |
18747585 |
tgcgtatgcgggagctttagtgcaccgggctgccct |
18747620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 38262330 - 38262198
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||| || ||||| | ||| ||||||||||| |||| ||||||||||| ||| || |||| |
|
|
| T |
38262330 |
aaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcccgaacactgc |
38262231 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||| |
|
|
| T |
38262230 |
gtatgcgggagctttagtgcaccggattgccct |
38262198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 32233270 - 32233137
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| ||||||||||||| |||||||||| ||||| | |||||| |||||||||| |||| || |||||| |
|
|
| T |
32233270 |
gaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggcagcgtatattacaccaaatggtgggattccttcccaaaccctg |
32233171 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||| |||||||| |||||||||| |||||| |
|
|
| T |
32233170 |
catatgagggagcttcagtgcaccgggctgccct |
32233137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 127 - 243
Target Start/End: Original strand, 13805101 - 13805217
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||| |||||||||||||||| ||| | | ||| |||||||| ||||||||||| |||||||||||| |||||||||||| ||| | |||||||| |
|
|
| T |
13805101 |
gaaaggtaacgggttcaagtcctggaaatagcctctggtgtaaaacaggggtaaggctgtgtacaatacaccaaatggtgggaccacttcctggaccctg |
13805200 |
T |
 |
| Q |
227 |
cgtatgcgggagctttg |
243 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13805201 |
cgtatgcgggagctttg |
13805217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 35787371 - 35787271
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
||||||||||||| | ||||||| ||||||||||||||| ||||| |||||||||| ||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
35787371 |
tcttgtgtaaaaacatggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgggttgccc |
35787272 |
T |
 |
| Q |
260 |
t |
260 |
Q |
| |
|
| |
|
|
| T |
35787271 |
t |
35787271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 129 - 233
Target Start/End: Original strand, 46354195 - 46354302
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
46354195 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
46354294 |
T |
 |
| Q |
226 |
gcgtatgc |
233 |
Q |
| |
|
|| ||||| |
|
|
| T |
46354295 |
gcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 127 - 241
Target Start/End: Original strand, 19266449 - 19266564
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||| |||||||||||||||||| | | |||| ||||||| ||||||||||||||||||||||||| ||| |||||| ||||| ||||||||| |
|
|
| T |
19266449 |
gaaaggtcgtgggttcaagtcctgaaaatagccacttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaattgtgggatcccttcccggaccct |
19266548 |
T |
 |
| Q |
226 |
gcgtatgcgggagctt |
241 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
19266549 |
gcgtatgcgggagctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 160 - 260
Target Start/End: Original strand, 23231589 - 23231690
Alignment:
| Q |
160 |
tcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||||||||||| ||||||||||| ||| ||||||||||||||| |||||| |||||||| ||| || |
|
|
| T |
23231589 |
tcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagtttcc |
23231688 |
T |
 |
| Q |
259 |
ct |
260 |
Q |
| |
|
|| |
|
|
| T |
23231689 |
ct |
23231690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 128 - 260
Target Start/End: Complemental strand, 23419809 - 23419676
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||| ||||||||| ||| ||||| | ||||||||||||| |||||||| |||||||||||||||| |||||||||||||||| | |||| || |
|
|
| T |
23419809 |
aaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcctagaccttg |
23419710 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||| |||||| ||||| ||||| |||| |||||| |
|
|
| T |
23419709 |
cgtgtgcgggggctttagtgcatcgggctgccct |
23419676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 132 - 248
Target Start/End: Complemental strand, 8149077 - 8148960
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgt--aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgt |
229 |
Q |
| |
|
|||||| ||||||||||||||||| || |||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| || || | ||||| |
|
|
| T |
8149077 |
gtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccaga-cttgcgt |
8148979 |
T |
 |
| Q |
230 |
atgcgggagctttggtgca |
248 |
Q |
| |
|
||||| ||| ||| ||||| |
|
|
| T |
8148978 |
atgcgagagttttagtgca |
8148960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 16341277 - 16341412
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||| || ||||| | ||||||||||||| ||||||||||| ||||||||||||| || ||||||| || ||| ||||||| |
|
|
| T |
16341277 |
gaaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaatggtgggccctcttcccggacct |
16341376 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||||||||||||||||||||||| |||||| |
|
|
| T |
16341377 |
atcatatgcgggagctttggtgcaccgggctgccct |
16341412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 127 - 258
Target Start/End: Complemental strand, 47077989 - 47077859
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||| ||| |||| | |||||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
47077989 |
gaaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaa-tagagtaaagttgcgtacaatacacaaaatggtgggaccccttcccaaacccta |
47077891 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
| |||||||||||| | ||||||||| ||||| |
|
|
| T |
47077890 |
catatgcgggagctctagtgcaccggattgcc |
47077859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 138 - 240
Target Start/End: Complemental strand, 2663058 - 2662958
Alignment:
| Q |
138 |
ggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcggga |
237 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||| |||||||||||||||||||||||||| |||||||||| ||||| | |||||||| ||||||||| |
|
|
| T |
2663058 |
ggttcaagtcctggaaacagcctcttgtgtaaaa-tagggtaaggctgcgtacaatacaccaaatggtggga-cccttttcagaccctgcatatgcggga |
2662961 |
T |
 |
| Q |
238 |
gct |
240 |
Q |
| |
|
||| |
|
|
| T |
2662960 |
gct |
2662958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 244
Target Start/End: Complemental strand, 48123620 - 48123502
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaa-aatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| |||||||||||||| ||||| | ||||||||||| || ||||||| |||| ||||||||||| |||||||||||||||| | ||||| | |
|
|
| T |
48123620 |
gaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacaccaaatggtgggacccctttctggaccat |
48123521 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttgg |
244 |
Q |
| |
|
|| |||||||||| ||||| |
|
|
| T |
48123520 |
gcatatgcgggaggtttgg |
48123502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 260
Target Start/End: Original strand, 42476873 - 42477004
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||||| ||||||| ||| ||||| |||||||||||| ||| ||||||||||||||||||||| |||||||||||||||| | | | |||| |
|
|
| T |
42476873 |
aaaggtcacggattcaagttctggaaacagtctcttgtgtaaaacaagg-taaggctgcgtacaatacaccaaatggtgggaccccttcctaggctctgc |
42476971 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||| | ||||||| ||||||||| |
|
|
| T |
42476972 |
atatgcgggagctctagtgcaccaggttgccct |
42477004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 127 - 253
Target Start/End: Complemental strand, 28362281 - 28362155
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatag-ggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| |||||||||||| |||| | ||||||||||||| ||||||||||||||||||||||| |||||||||||||||| || |||| | |
|
|
| T |
28362281 |
gaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagacctt |
28362182 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|| |||| ||||||||| |||||||||| |
|
|
| T |
28362181 |
gcatatgtgggagcttt-gtgcaccggg |
28362155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 134 - 250
Target Start/End: Original strand, 39123896 - 39124018
Alignment:
| Q |
134 |
cacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggta----aggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||| |||||||||| |||||||| || |||||||||||||| ||||||||||| |
|
|
| T |
39123896 |
cacgggttcaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgtaaaatacaccaaaaatggtgggaccccttcccggaccctgc |
39123995 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
39123996 |
gtatgagggagctttggtgcacc |
39124018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 6736889 - 6737020
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||| |||||| | |||||| |||| ||||||||||| |||||| ||| || || ||||||| || |
|
|
| T |
6736889 |
gaaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaacaaggtaagactgcatacaatacaccaaatggt-ggagcctttcccggaccttg |
6736987 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| | ||| |||| |||||||||| |||||| |
|
|
| T |
6736988 |
cgtacgaaggaccttt-gtgcaccgggctgccct |
6737020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 127 - 237
Target Start/End: Original strand, 7644955 - 7645066
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||| ||||| |||||||| |||||||||||||| ||| |||||||||||| || ||||| |
|
|
| T |
7644955 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaaaattgtgggacccctt-cctgaccc |
7645053 |
T |
 |
| Q |
225 |
tgcgtatgcggga |
237 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7645054 |
tgcgtatgcggga |
7645066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 140 - 258
Target Start/End: Original strand, 1408469 - 1408588
Alignment:
| Q |
140 |
ttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggag |
238 |
Q |
| |
|
||||||||||| ||| | | ||||||||||||| | |||||||||| |||||||||| | |||||||||||||||| ||||||||||||||||| | | |
|
|
| T |
1408469 |
ttcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgcagaat |
1408568 |
T |
 |
| Q |
239 |
ctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||| || |||||| ||||| |
|
|
| T |
1408569 |
ctttagttcaccggattgcc |
1408588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 22699106 - 22698969
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgcc-ggac |
222 |
Q |
| |
|
||||||| | |||||||||||||| ||| | ||||||||||||| |||||||| |||||||||||||||| || ||||||||||| || || |||| |
|
|
| T |
22699106 |
gaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggacccttttcccggac |
22699007 |
T |
 |
| Q |
223 |
cctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| ||||||||||||| | |||||||||||| |||| |
|
|
| T |
22699006 |
cctgtgtatgcgggagctatagtgcaccgggttaccct |
22698969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 198
Target Start/End: Original strand, 12473303 - 12473375
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc |
198 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| |||||||| ||||| ||||||||| ||||||||||||||| |
|
|
| T |
12473303 |
gaaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagggtaaggatgcgtacaatacacc |
12473375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 238
Target Start/End: Complemental strand, 14099142 - 14099030
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| ||||| |||||||| ||| | | | ||||||||||| ||| |||| |||||||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
14099142 |
gaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccct |
14099043 |
T |
 |
| Q |
226 |
gcgtatgcgggag |
238 |
Q |
| |
|
||||||| |||| |
|
|
| T |
14099042 |
acgtatgcaggag |
14099030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 238
Target Start/End: Complemental strand, 14409159 - 14409047
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| ||||| |||||||| ||| | | | ||||||||||| ||| |||| |||||||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
14409159 |
gaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccct |
14409060 |
T |
 |
| Q |
226 |
gcgtatgcgggag |
238 |
Q |
| |
|
||||||| |||| |
|
|
| T |
14409059 |
acgtatgcaggag |
14409047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 179 - 260
Target Start/End: Complemental strand, 45019010 - 45018925
Alignment:
| Q |
179 |
aaggctgcgtacaatacaccgaa----tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||| || |||||| ||||||| |||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
45019010 |
aaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccct |
45018925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 132 - 253
Target Start/End: Original strand, 21566439 - 21566562
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgt |
229 |
Q |
| |
|
||||| |||||||||| || |||| | ||||||||||||| || | ||| |||||||||||||||| || |||| ||||||||| ||| ||||||| | |
|
|
| T |
21566439 |
gtcacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcat |
21566538 |
T |
 |
| Q |
230 |
atgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
21566539 |
atgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 129 - 242
Target Start/End: Complemental strand, 28078265 - 28078152
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
||||||||||||||||||||| ||||| || ||| ||||| ||||||||| ||| | ||||||||| |||||||||||||||| ||| | ||||| |
|
|
| T |
28078265 |
aaggtcacgggttcaagtcctagaaacagtctcgtgtaaaaaaacagggtaaggttgcatgcaatacaccaaatggtgggaccccttcccgaatcctgca |
28078166 |
T |
 |
| Q |
229 |
tatgcgggagcttt |
242 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
28078165 |
tatgcgagagcttt |
28078152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 35203438 - 35203556
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||| ||||| ||| |||| |||||||||||| ||| |||||||||| ||||| | | || |
|
|
| T |
35203438 |
gaaaggtcacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcctgaact |
35203537 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
35203538 |
ctacgtatgcgggagcttt |
35203556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 249
Target Start/End: Complemental strand, 21139850 - 21139761
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
||||||||||||| || |||||| || |||| |||||| |||||||||||||||| ||| || ||| |||||||| |||||| |||||| |
|
|
| T |
21139850 |
tcttgtgtaaaaacagagtaaggttggatacagtacaccaaatggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac |
21139761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 139 - 260
Target Start/End: Original strand, 22065599 - 22065720
Alignment:
| Q |
139 |
gttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggag |
238 |
Q |
| |
|
|||||||| || ||||||| ||||||||||||||||||||| ||||| ||||||| | | ||| ||| |||||||| ||| || || |||||| |||| |
|
|
| T |
22065599 |
gttcaagttttggaaacaacctcttgtgtaaaaatagggtaaagctgcatacaataaagcaaatagtgagaccccttcccgaactatgtgtatgcaggag |
22065698 |
T |
 |
| Q |
239 |
ctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||| ||| |||||| |||||| |
|
|
| T |
22065699 |
ttttagtgtaccgggctgccct |
22065720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 252
Target Start/End: Complemental strand, 36267900 - 36267827
Alignment:
| Q |
180 |
aggctgcgtacaatacaccgaatggtgggaccc-cttgccggaccctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
||||||||||||||||||| |||||| |||||| || ||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
36267900 |
aggctgcgtacaatacaccaaatggttggacccatttcccgaaccctgtgtatgcgggagctttagtgcaccgg |
36267827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 132 - 232
Target Start/End: Complemental strand, 15108527 - 15108427
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
231 |
Q |
| |
|
|||||| |||||||||||| ||||| ||||||||||||| | |||||||||| |||||||||| | ||| |||||| ||||| || |||||| |||| |
|
|
| T |
15108527 |
gtcacgagttcaagtcctggaaacagtttcttgtgtaaaaacaaggtaaggctgtgtacaatacatcaaatagtgggatcccttcccaaaccctgtgtat |
15108428 |
T |
 |
| Q |
232 |
g |
232 |
Q |
| |
|
| |
|
|
| T |
15108427 |
g |
15108427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 129 - 185
Target Start/End: Original strand, 18327035 - 18327091
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctg |
185 |
Q |
| |
|
|||||||||||||||||||| | ||||| | ||||||||||||| |||||||||||| |
|
|
| T |
18327035 |
aaggtcacgggttcaagtcccggaaacagcctcttgtgtaaaaacagggtaaggctg |
18327091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 184 - 260
Target Start/End: Complemental strand, 23066003 - 23065927
Alignment:
| Q |
184 |
tgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||| ||| | ||||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
23066003 |
tgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgccct |
23065927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 220 - 260
Target Start/End: Original strand, 36602540 - 36602580
Alignment:
| Q |
220 |
gaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36602540 |
gaccctgcgtatgcgggagctttagtgcaccgggttgccct |
36602580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 168 - 260
Target Start/End: Complemental strand, 3469271 - 3469177
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||||| || ||||||||||||||| || ||| |||||||||| | ||||||| ||||||||||||||| |||| | |||||||||| |
|
|
| T |
3469271 |
aaaaacagggtacggttgcgtacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccct |
3469177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 185
Target Start/End: Original strand, 7193084 - 7193143
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaa-aatagggtaaggctg |
185 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
7193084 |
gaaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaacaatatggtaaggctg |
7193143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 182
Target Start/End: Complemental strand, 42495971 - 42495916
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaagg |
182 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||| |||||| ||||||||| |
|
|
| T |
42495971 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaacagggtaagg |
42495916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 174 - 237
Target Start/End: Original strand, 33500560 - 33500625
Alignment:
| Q |
174 |
agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcggga |
237 |
Q |
| |
|
|||||||| |||||||| |||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33500560 |
agggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcggga |
33500625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 176 - 260
Target Start/End: Complemental strand, 13792237 - 13792152
Alignment:
| Q |
176 |
ggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| |||| ||||||||||| || ||| |||||||||| || ||||||||||||| |||||||| |||||||| | |||||| |
|
|
| T |
13792237 |
ggtaagactgcatacaatacacccaaatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgagctgccct |
13792152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 187 - 260
Target Start/End: Complemental strand, 23619052 - 23618979
Alignment:
| Q |
187 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||| | |||||||||||||||| | |||| ||||| ||| |||||||| ||||| ||||||||||| |
|
|
| T |
23619052 |
gtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgccct |
23618979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 211 - 259
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
| Q |
211 |
cccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc |
42495865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 242
Target Start/End: Complemental strand, 44123749 - 44123642
Alignment:
| Q |
135 |
acgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcg |
234 |
Q |
| |
|
|||||||||||| ||| ||||| | ||||||||||||| | ||||||| ||| | |||||||| || |||||||| || ||||| |||||||||| |
|
|
| T |
44123749 |
acgggttcaagtactggaaacagcctcttgtgtaaaaacaaggtaaggttgcatgaaatacaccatataatgggacccgttctcggacactgcgtatgca |
44123650 |
T |
 |
| Q |
235 |
ggagcttt |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
44123649 |
ggagcttt |
44123642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 14732958 - 14732831
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||| |||| |||||||||||||| ||||| | || ||| ||||| ||||||||||||||| ||||||||| ||||||| || |||| ||| ||| |
|
|
| T |
14732958 |
gaaaagtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggtaaggctgcgt-caatacaccaaaaatggtgaaactccttcccgaacc |
14732860 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
||| |||||||||||||| ||||||||| |
|
|
| T |
14732859 |
ctgtttatgcgggagctttagtgcaccgg |
14732831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 209
Target Start/End: Original strand, 23223679 - 23223760
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtggga |
209 |
Q |
| |
|
|||||||| |||| ||||||||||| | | ||||||||||||| || ||||| ||||||||||||| |||||||||||| |
|
|
| T |
23223679 |
aaggtcacaggttagagtcctgaaaagagcctcttgtgtaaaaaataaaataaggttgcgtacaatacatcgaatggtggga |
23223760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 132 - 196
Target Start/End: Original strand, 43852047 - 43852111
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaataca |
196 |
Q |
| |
|
||||||||||||||||||||||| ||| |||| ||| ||||| ||||||||||| |||||||||| |
|
|
| T |
43852047 |
gtcacgggttcaagtcctgaaaa-aacctcttctgtaaaaaacagggtaaggctatgtacaataca |
43852111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 204 - 260
Target Start/End: Original strand, 11888414 - 11888470
Alignment:
| Q |
204 |
gtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||| | |||||||| |||||| ||||||| |||||| |||||||||| |
|
|
| T |
11888414 |
gtgggacccctttctggaccctgtgtatgcaggagcttcagtgcactgggttgccct |
11888470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 219 - 251
Target Start/End: Original strand, 25434112 - 25434144
Alignment:
| Q |
219 |
ggaccctgcgtatgcgggagctttggtgcaccg |
251 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
25434112 |
ggaccctgcgtatgcgggagctttagtgcaccg |
25434144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 73)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 26869728 - 26869861
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | ||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| || |
|
|
| T |
26869728 |
gaaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttgccggaccatg |
26869827 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26869828 |
cgtatgcgggagctttggtgcaccgggttgccct |
26869861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 40272946 - 40272814
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
40272946 |
aaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
40272847 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
40272846 |
gtatgcgggagctttagtgcaccgggttgccct |
40272814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 13628928 - 13628792
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaa-aaatagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||| ||| ||||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
13628928 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacc |
13628829 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13628828 |
ctgcgtatgcgggagctttagtgcaccgggttgccct |
13628792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 22609789 - 22609920
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
||||| ||||||||||||| || ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
22609789 |
aaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcg |
22609888 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
22609889 |
tatgcgggagcttcagtgcaccgggttgccct |
22609920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 1217111 - 1217243
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| ||||| |||||||||| |||||||||| |
|
|
| T |
1217111 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggcgggaccccttcccggaccctg |
1217209 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
1217210 |
catatgcgggagctctagtgcaccgggttgccct |
1217243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 129 - 252
Target Start/End: Complemental strand, 45948972 - 45948848
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||| ||||| ||||||| ||||||||||||| |||||||||||||| ||||||||||| | |||||||||||||| |||||||||| |
|
|
| T |
45948972 |
aaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattggtgggaccccttctcggaccctgc |
45948873 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
45948872 |
gtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 22123051 - 22122919
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
22123051 |
gaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
22122953 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||| ||||| | ||||||||||||||||| |
|
|
| T |
22122952 |
catatgcgagagctctagtgcaccgggttgccct |
22122919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 135 - 260
Target Start/End: Original strand, 31592878 - 31593002
Alignment:
| Q |
135 |
acgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcg |
234 |
Q |
| |
|
|||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| ||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
31592878 |
acgggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcg |
31592976 |
T |
 |
| Q |
235 |
ggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| | ||||||||||||||||| |
|
|
| T |
31592977 |
ggagctctagtgcaccgggttgccct |
31593002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 39203537 - 39203669
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| |||||||||||| ||||| | |||||||||||| ||||||||| ||||||||||||||| |||||||||||||||| ||||||| || |
|
|
| T |
39203537 |
gaaaggtcacaggttcaagtccttgaaacagcctcttgtgtaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccttg |
39203635 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||| |
|
|
| T |
39203636 |
catatgcgggagctttagtgcaccgggttgccct |
39203669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 128 - 260
Target Start/End: Complemental strand, 46421172 - 46421036
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
46421172 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
46421073 |
T |
 |
| Q |
225 |
tgcgtatgcgggagcttt-ggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
46421072 |
tgcgtatgcgggagctttaagtgcaccggtttgccct |
46421036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 128 - 260
Target Start/End: Complemental strand, 29366857 - 29366722
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||| |||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
29366857 |
aaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
29366758 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
29366757 |
tgcgtatgtgggagctttagtgcactgggttgccct |
29366722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 13730738 - 13730604
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| |||||||||||| |||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
13730738 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaataatggtgggaccccttcccggacccc |
13730639 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||| |
|
|
| T |
13730638 |
gcatatgcgggagctttagtgcaccgggttgccct |
13730604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 26573148 - 26573282
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | || |||||||||| ||||||||||||||||||||||||| | |||||||||||| | ||||||||| |
|
|
| T |
26573148 |
gaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccatcccggaccct |
26573247 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||| ||||||| ||||||| || |||||| |
|
|
| T |
26573248 |
gcgtatgcgtgagctttagtgcaccaggctgccct |
26573282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 130 - 251
Target Start/End: Complemental strand, 6411954 - 6411833
Alignment:
| Q |
130 |
aggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgt |
229 |
Q |
| |
|
|||||| ||||||||||| || ||||| | ||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||| || |||| ||||| |
|
|
| T |
6411954 |
aggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgt |
6411855 |
T |
 |
| Q |
230 |
atgcgggagctttggtgcaccg |
251 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
6411854 |
atgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 146 - 260
Target Start/End: Original strand, 54484730 - 54484846
Alignment:
| Q |
146 |
tcctgaaaacaacatcttgtgtaaaaatag--ggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
243 |
Q |
| |
|
||||| ||||| | ||||||||||||| | ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54484730 |
tcctggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta |
54484829 |
T |
 |
| Q |
244 |
gtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
54484830 |
gtgcaccgggttgccct |
54484846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 5173856 - 5173721
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||| | |||||| ||| | ||||||||| || ||||||| |||||| ||||||| |
|
|
| T |
5173856 |
gaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaacaaagtaaggttgcatgcaatacaccaaaaatggtggggccccttcccggacct |
5173757 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5173756 |
tgcgtatgcgggagctttagtgcaccgggttgccct |
5173721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 132 - 260
Target Start/End: Original strand, 16735467 - 16735595
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
231 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||| ||||| ||||||||||||||||||||||||| |||||||||||||||| |||||| |||||||| |
|
|
| T |
16735467 |
gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtat |
16735566 |
T |
 |
| Q |
232 |
gcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| ||||| |||||| |||||||||| |
|
|
| T |
16735567 |
gcggtagcttcagtgcactgggttgccct |
16735595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 516430 - 516567
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa---tggtgggaccccttgccggac |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| |||||||||||||| |||||| ||| || ||| |||||||||| || ||| |
|
|
| T |
516430 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcgggaccccttccccgac |
516529 |
T |
 |
| Q |
223 |
cctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
516530 |
cctgcgtatgcgggagctttagtgcaccgggttgccct |
516567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 8247825 - 8247688
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| ||||||||| ||||||||||||||| | |||||||||| |||| ||||||| |
|
|
| T |
8247825 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggactccttcccggacc |
8247726 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagcttt-ggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
8247725 |
ctgcgtatgcgggagctttaagtgcactgggttgccct |
8247688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 134 - 260
Target Start/End: Complemental strand, 10795554 - 10795425
Alignment:
| Q |
134 |
cacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgta |
230 |
Q |
| |
|
||||||||||||||||| ||||| | |||||||||||| | ||||||||||||||||||||||||| || |||||||||||||| | |||||||||||| |
|
|
| T |
10795554 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgta |
10795455 |
T |
 |
| Q |
231 |
tgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |
|
|
| T |
10795454 |
tgcgggagcttcagtgcaccaggttgccct |
10795425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 52926344 - 52926221
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||| |||||||||||||||||||||| ||||||||||| |||| |||||||||||| |
|
|
| T |
52926344 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgta--------gtaaggctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcg |
52926253 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |
|
|
| T |
52926252 |
tatgcgggagctttagcgcaccgggttgccct |
52926221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 54374482 - 54374365
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||| |||||||||| || ||||||| ||||||||||||| ||||||||||||||||||||| |||| || |||||||||||||| |||||||| |
|
|
| T |
54374482 |
gaaaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggaccc |
54374383 |
T |
 |
| Q |
225 |
tgcgtatgcgggagcttt |
242 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
54374382 |
tgcatatgcgggagcttt |
54374365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 127 - 249
Target Start/End: Complemental strand, 34420780 - 34420656
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||| ||||||| || |||||||||||||| ||||||| |
|
|
| T |
34420780 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaatggtgggaccccttcccggacct |
34420681 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
|||||||| ||||||||| |||||| |
|
|
| T |
34420680 |
tgcgtatgtgggagctttagtgcac |
34420656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 53996702 - 53996567
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||| ||||||||| || ||||||| ||||||||||||| ||||||||||||| ||||||||||| || |||||||||||||| || ||| | |
|
|
| T |
53996702 |
gaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaatggtgggaccccttccctgacac |
53996603 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
53996602 |
tgcgtatgtgggagctttagtgcaccgggctgccct |
53996567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 129 - 258
Target Start/End: Original strand, 7943013 - 7943143
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||| ||||||||||| ||||| |||||||| |||||| |||||||| |||||||||||||| | |||||||||| ||||| || |||| ||| |
|
|
| T |
7943013 |
aaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgggatccctttccagaccatgc |
7943112 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |
|
|
| T |
7943113 |
gtatgcgggagctttagtgcactgggttgcc |
7943143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 12914171 - 12914037
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| |||||||||||| ||||| | ||||||||||||| |||||||||| |||||||||||||| ||||||| |||||||| || |||||| |
|
|
| T |
12914171 |
gaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcggcgtacaatacaccaaatggtgagaccccttcccagaccct |
12914072 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| ||||||||||||| |||||||||||||||| |
|
|
| T |
12914071 |
gcatatgcgggagcttcaatgcaccgggttgccct |
12914037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 160 - 260
Target Start/End: Original strand, 15797276 - 15797375
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||| ||||||| | |||||||||||||||| |
|
|
| T |
15797276 |
tcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccc |
15797374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 169 - 260
Target Start/End: Complemental strand, 34771457 - 34771366
Alignment:
| Q |
169 |
aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | |||||||||| |||||| |
|
|
| T |
34771457 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgccct |
34771366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 54032693 - 54032573
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
54032693 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtggg------------accctgc |
54032606 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
54032605 |
gtatgcgggagctttagtgcaccgggttgccct |
54032573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 138 - 260
Target Start/End: Original strand, 14986989 - 14987114
Alignment:
| Q |
138 |
ggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcg |
234 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| | |||||||||||| || ||||||| ||| |||||| |
|
|
| T |
14986989 |
ggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcg |
14987088 |
T |
 |
| Q |
235 |
ggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| |||||||||||| |||| |
|
|
| T |
14987089 |
ggagctttagtgcaccgggtttccct |
14987114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 151 - 260
Target Start/End: Complemental strand, 45786328 - 45786216
Alignment:
| Q |
151 |
aaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgc |
247 |
Q |
| |
|
|||||| | ||||||||||||| ||||||||||||||||||||||||| || |||||||||||||| |||||||||||| |||| |||||||| |||| |
|
|
| T |
45786328 |
aaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgc |
45786229 |
T |
 |
| Q |
248 |
accgggttgccct |
260 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45786228 |
accgggttgccct |
45786216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 33926104 - 33926220
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| |||||||||||||| ||| | | ||||||||||||| |||||||||||| |||||||||||| |||||||||||||||| | ||||||| |
|
|
| T |
33926104 |
gaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaaacagggtaaggctgtgtacaatacaccataatggtgggaccccttcctggaccct |
33926203 |
T |
 |
| Q |
226 |
gcgtatgcgggagcttt |
242 |
Q |
| |
|
|| |||||| ||||||| |
|
|
| T |
33926204 |
gcatatgcgagagcttt |
33926220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 168 - 260
Target Start/End: Complemental strand, 353445 - 353351
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
353445 |
aaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 45139614 - 45139480
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||| | ||||||||||||| ||||||||||| |||||||||||||||| || || | |
|
|
| T |
45139614 |
gaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccaga-c |
45139516 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||| |
|
|
| T |
45139515 |
ctgcgtatgcgggaacttt-gtgcaccgggctgccct |
45139480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 151 - 231
Target Start/End: Original strand, 47624087 - 47624167
Alignment:
| Q |
151 |
aaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
231 |
Q |
| |
|
|||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||| |
|
|
| T |
47624087 |
aaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgtgtat |
47624167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 49013578 - 49013475
Alignment:
| Q |
160 |
tcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| || || ||||||||||| ||||||||||||| |
|
|
| T |
49013578 |
tcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttg |
49013479 |
T |
 |
| Q |
257 |
ccct |
260 |
Q |
| |
|
|||| |
|
|
| T |
49013478 |
ccct |
49013475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 4495798 - 4495678
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||||||| | | | ||||||||||| ||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
4495798 |
aaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtggg------------accctgc |
4495711 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
4495710 |
gtatgcgggagctttagtgcaccgggttgccct |
4495678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 181 - 260
Target Start/End: Complemental strand, 25517251 - 25517172
Alignment:
| Q |
181 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
25517251 |
ggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccct |
25517172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 127 - 243
Target Start/End: Complemental strand, 30928283 - 30928166
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||| |||| | ||||||| || ||| |||||||| | ||| |||||||||| ||||||||| |
|
|
| T |
30928283 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcgggaccccttcccggaccct |
30928184 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttg |
243 |
Q |
| |
|
|| |||| |||||||||| |
|
|
| T |
30928183 |
gcatatgtgggagctttg |
30928166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 128 - 260
Target Start/End: Complemental strand, 7697020 - 7696894
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||| ||||| |||||| |||||| |||| |
|
|
| T |
7697020 |
aaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgg-----ccccttcccggacactgc |
7696927 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| ||||||| | |||||||||||| |||| |
|
|
| T |
7696926 |
atatgtgggagctctagtgcaccgggtttccct |
7696894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 127 - 258
Target Start/End: Original strand, 19731023 - 19731155
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||| | ||||||||| ||| | | ||||||||||||| | ||||||| ||||||||||||||| | ||||||||||| || || ||| || |
|
|
| T |
19731023 |
gaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactct |
19731122 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
| |||||| |||||||| |||||||||| |||| |
|
|
| T |
19731123 |
gtgtatgcaggagctttagtgcaccgggctgcc |
19731155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 242
Target Start/End: Original strand, 9276318 - 9276400
Alignment:
| Q |
160 |
tcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||| |||||| || ||||||||||||||||||||| |||| |
|
|
| T |
9276318 |
tcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttt |
9276400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 25944490 - 25944625
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata-gggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||| |||||||||||||| |||| | ||| ||||||||| ||| ||||||| |||||||||||| || |||||||||||||| || ||||| |
|
|
| T |
25944490 |
gaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaaaatggtgggaccccttccctgaccc |
25944589 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| ||||||||| | ||||| || |||||| |
|
|
| T |
25944590 |
tgcgtatgtgggagctttagcgcaccaggctgccct |
25944625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 127 - 189
Target Start/End: Complemental strand, 10870087 - 10870025
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgta |
189 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
10870087 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgta |
10870025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 138 - 258
Target Start/End: Original strand, 55401208 - 55401330
Alignment:
| Q |
138 |
ggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgg |
235 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||||| ||| |||| ||||||| |||||||| || |||||||||||||| |||||| | ||||||||| |
|
|
| T |
55401208 |
ggttcaagtcctgtaaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcgg |
55401307 |
T |
 |
| Q |
236 |
gagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||| ||||||||| |||| |
|
|
| T |
55401308 |
gagcttttttgcaccgggctgcc |
55401330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 209
Target Start/End: Complemental strand, 45620965 - 45620881
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaatggtggga |
209 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| | ||||||||||||| | |||||||||||||||||||||||| | |||||||| |
|
|
| T |
45620965 |
gaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaattggtggga |
45620881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 258
Target Start/End: Original strand, 19751599 - 19751731
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||| | ||||||||| ||| | | |||||||||||||| | ||||||| ||||||||||||||| | ||||||||||| || || ||| | |
|
|
| T |
19751599 |
gaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagacttt |
19751698 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
| |||||| ||||||| |||||||||| |||| |
|
|
| T |
19751699 |
gtgtatgcatgagctttagtgcaccgggctgcc |
19751731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 260
Target Start/End: Complemental strand, 24851363 - 24851303
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
24851363 |
aatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccct |
24851303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 9607224 - 9607342
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||| ||||||||||||| ||||| | ||||| ||||||| |||||||||||||||| |||||||| |||| ||||||||||| || |||| |
|
|
| T |
9607224 |
gaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtagaatacaccaataatgttgggaccccttcccagacc |
9607323 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagcttt |
242 |
Q |
| |
|
| || |||||||||||||| |
|
|
| T |
9607324 |
ccgcatatgcgggagcttt |
9607342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 260
Target Start/End: Original strand, 30452892 - 30452950
Alignment:
| Q |
202 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
30452950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 184 - 252
Target Start/End: Complemental strand, 829521 - 829452
Alignment:
| Q |
184 |
tgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
||||||||||||||| || |||||||||||||| ||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
829521 |
tgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 207 - 260
Target Start/End: Complemental strand, 10484671 - 10484618
Alignment:
| Q |
207 |
ggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
10484618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 128 - 215
Target Start/End: Original strand, 29106571 - 29106659
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaatggtgggacccctt |
215 |
Q |
| |
|
|||| |||||||| |||||| |||||||||| |||||||| ||||||||| ||||| | ||||||||||||| ||| |||||| ||||| |
|
|
| T |
29106571 |
aaagatcacgggtacaagtcttgaaaacaacctcttgtgtaaaaaataggataaggttacgtacaatacaccaaattgtgggatccctt |
29106659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 128 - 258
Target Start/End: Complemental strand, 44403691 - 44403559
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatac-accgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| |||| |||||||| || | | |||||||||||| | | |||||||||||| | ||||| || |||||||||||||||| ||||||||| |
|
|
| T |
44403691 |
aaaggtcacaggttaaagtcctgggaatagcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaatggtgggaccccttcccggaccct |
44403592 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||| | |||||| |||||||||| |||| |
|
|
| T |
44403591 |
acgtatgctgaagctttagtgcaccgggctgcc |
44403559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 217 - 260
Target Start/End: Original strand, 47624211 - 47624254
Alignment:
| Q |
217 |
ccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47624211 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
47624254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 139 - 248
Target Start/End: Complemental strand, 43114994 - 43114882
Alignment:
| Q |
139 |
gttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaagg-ctgcgtacaatacaccgaatggtgggaccccttgccggaccc-tgcgtatgcg |
234 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||| | |||||||| || | ||||||||||| ||||||||||||| || | |||||| |||||||||| |
|
|
| T |
43114994 |
gttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtgggaccc-ttcctggacccctgcgtatgcg |
43114896 |
T |
 |
| Q |
235 |
ggagctttggtgca |
248 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
43114895 |
ggagctttagtgca |
43114882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 50625056 - 50624955
Alignment:
| Q |
160 |
tcttgtgta-aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||||| |||| ||||||||| |||||||||||||| ||||||||| |||| | || ||||||||| | ||||||||| |||||||||| |||| |
|
|
| T |
50625056 |
tcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcaccgggctgcc |
50624957 |
T |
 |
| Q |
259 |
ct |
260 |
Q |
| |
|
|| |
|
|
| T |
50624956 |
ct |
50624955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 253
Target Start/End: Complemental strand, 52428614 - 52428479
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtc-ctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgg-------gaccccttgc |
217 |
Q |
| |
|
||||||||||||||| ||||| ||| || || | |||||||||||| | ||||||||||||||||||||||||| ||| |||| ||||||| |
|
|
| T |
52428614 |
gaaaggtcacgggtttaagtctctggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccccaaaccccttct |
52428515 |
T |
 |
| Q |
218 |
cggaccctgcgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|||||||| |||||| ||||||||| |||||||||| |
|
|
| T |
52428514 |
cggaccctacgtatgtgggagctttagtgcaccggg |
52428479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 127 - 198
Target Start/End: Complemental strand, 1121361 - 1121289
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaa-aaatagggtaaggctgcgtacaatacacc |
198 |
Q |
| |
|
||||||||||| ||| |||||||| ||||||| |||||||||| ||||| ||| || |||||||||||||||| |
|
|
| T |
1121361 |
gaaaggtcacgtgtttaagtcctggaaacaacttcttgtgtaagaaataaggtgagactgcgtacaatacacc |
1121289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 160 - 256
Target Start/End: Original strand, 26292386 - 26292481
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
|||||||||||| |||||||| | |||||| ||||||| |||| ||||| ||||| ||| ||||||| ||||||||| || | ||||||||||||| |
|
|
| T |
26292386 |
tcttgtgtaaaac-agggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggttg |
26292481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 168 - 260
Target Start/End: Original strand, 33235595 - 33235686
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||||||| ||| ||||||||||| ||||||||||||||| | | |||| | ||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
33235595 |
aaaaacagggtaagactgtgtacaatacactaaatggtgggacccctcg-cagaccttacgtatgcggaagctttagtgcaccaggttgccct |
33235686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 260
Target Start/End: Original strand, 40390357 - 40390396
Alignment:
| Q |
221 |
accctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40390357 |
accctgcgtatgcgggagctttagtgcaccgggttgccct |
40390396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 196
Target Start/End: Original strand, 39212011 - 39212081
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaa-aatagggtaaggctgcgtacaataca |
196 |
Q |
| |
|
|||| ||||||||||||||||||| ||| ||| ||||||||||| || | |||||| |||||||||||||| |
|
|
| T |
39212011 |
gaaatgtcacgggttcaagtcctggaaataacctcttgtgtaaataacaaggtaagactgcgtacaataca |
39212081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 127 - 187
Target Start/End: Original strand, 12525428 - 12525489
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcg |
187 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
12525428 |
gaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggtaaggctgcg |
12525489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 135 - 197
Target Start/End: Original strand, 21875042 - 21875106
Alignment:
| Q |
135 |
acgggttcaagtcctgaaaacaacatcttgtgt--aaaaatagggtaaggctgcgtacaatacac |
197 |
Q |
| |
|
|||||||||| | ||| ||||||| |||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
21875042 |
acgggttcaaattctggaaacaacctcttgtgttaaaaaagagggtaaggctgcgtacaatacac |
21875106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 168 - 260
Target Start/End: Complemental strand, 31904951 - 31904858
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtggga-ccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||||| | |||||||||||||||| |||||||||| |||||| || || | | ||| |||||||||||| ||||||| || |||||| |
|
|
| T |
31904951 |
aaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagctttagtgcaccaggctgccct |
31904858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 221 - 260
Target Start/End: Complemental strand, 14266413 - 14266374
Alignment:
| Q |
221 |
accctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
14266413 |
accctgcgtatgcgggagctttagtgcactgggttgccct |
14266374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 160 - 260
Target Start/End: Original strand, 31831253 - 31831341
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| |||||| ||||||||||| |||||||| ||| | |||||||||||||||| |
|
|
| T |
31831253 |
tcttgtgtaaaa-tagggtaaggctgcatacaatacaccaaatggt-----------ccggaccctgcatatgcgggtgctctagtgcaccgggttgccc |
31831340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 260
Target Start/End: Original strand, 23871484 - 23871521
Alignment:
| Q |
223 |
cctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
23871484 |
cctgcgtatgcgggaactttagtgcaccgggttgccct |
23871521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 260
Target Start/End: Original strand, 24577917 - 24577990
Alignment:
| Q |
187 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||| |||||||||| || || || |||||||| ||| |||||||| | ||||||||| ||||||| |
|
|
| T |
24577917 |
gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgccct |
24577990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 260
Target Start/End: Original strand, 24578007 - 24578080
Alignment:
| Q |
187 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||| ||||||||||| | || || |||||| | ||||||||| || | ||||||||||||||||| |
|
|
| T |
24578007 |
gtacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgccct |
24578080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 203
Target Start/End: Original strand, 26782387 - 26782464
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaatg |
203 |
Q |
| |
|
|||||||||||| |||||||||| |||||| |||||||| ||||||||||||| |||| || |||||||| |||| |
|
|
| T |
26782387 |
gaaaggtcacggattcaagtccttgaaacaatctcttgtgtaaaaaatagggtaatgctgtataaaatacaccaaatg |
26782464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 260
Target Start/End: Complemental strand, 43956515 - 43956474
Alignment:
| Q |
219 |
ggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| |||||| |
|
|
| T |
43956515 |
ggacccagcgtatgcgggagctttagtgcaccgggctgccct |
43956474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 97; Significance: 1e-47; HSPs: 4)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 46832 - 46964
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||| ||| ||||||| |||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
46832 |
aaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
46931 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
46932 |
gtatgcgggagctttagtgcaccgggttgccct |
46964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 24903 - 24774
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| ||||||||||| |||| | ||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||| ||| ||||| |
|
|
| T |
24903 |
gaaaggtcatgggttcaagtc-----aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaacacaccaaatggtgggaccccttcccgaaccct |
24809 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||| |
|
|
| T |
24808 |
gcgtatgcgggagctttagtgcagccggttgccct |
24774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 141 - 260
Target Start/End: Original strand, 43672 - 43791
Alignment:
| Q |
141 |
tcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgc-cggaccctgcgtatgcgggagc |
239 |
Q |
| |
|
|||||| ||| ||||| | |||||||||||| ||| ||||||||||||||||||||| |||||||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
43672 |
tcaagttctggaaacagcgtcttgtgtaaaacaagg-taaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagc |
43770 |
T |
 |
| Q |
240 |
tttggtgcaccgggttgccct |
260 |
Q |
| |
|
| | |||||| | |||||||| |
|
|
| T |
43771 |
tctagtgcactgagttgccct |
43791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 174 - 242
Target Start/End: Complemental strand, 46796 - 46727
Alignment:
| Q |
174 |
agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||||||| ||| ||||||| ||| || |||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
46796 |
agggtaaggatgcatacaatataccaaaatggtgggaccccttcccagaccctgcgtatgcgggagcttt |
46727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 96; Significance: 5e-47; HSPs: 93)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 5648260 - 5648391
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
5648260 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcg |
5648359 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| |||||| |||||||||| |
|
|
| T |
5648360 |
tatgcgggagcttcagtgcactgggttgccct |
5648391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 6430761 - 6430628
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||||||| || ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||| |||||||||| |
|
|
| T |
6430761 |
gaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccacttcccggaccctg |
6430662 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| |
|
|
| T |
6430661 |
cgtatgcgggagctttagcgcaccgggttgccct |
6430628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 20224983 - 20225115
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
20224983 |
gaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
20225081 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
20225082 |
catatgcgggagctctagtgcaccgggttgccct |
20225115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 40915830 - 40915961
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| | ||||||||||||||||||||||| |||||||||| ||||| |||||||||||| |
|
|
| T |
40915830 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggagcccttcccggaccctgcg |
40915929 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||||||| ||||||| |
|
|
| T |
40915930 |
tatgcgggagcttcagtgcaccggattgccct |
40915961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 9832447 - 9832315
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
9832447 |
gaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
9832349 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||| ||| || | ||||||||||||||||| |
|
|
| T |
9832348 |
catatgcaggaactctagtgcaccgggttgccct |
9832315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 30639379 - 30639512
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||| ||||||| |||||||| |||||||||| |
|
|
| T |
30639379 |
gaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagaccccttcccggaccctg |
30639478 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||||| |||||| |||||||||| |
|
|
| T |
30639479 |
catatgcgggagctttagtgcactgggttgccct |
30639512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 127 - 252
Target Start/End: Original strand, 19027847 - 19027973
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||| || ||| || |
|
|
| T |
19027847 |
gaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaattggtgggacccctttccagactct |
19027946 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
||||||| ||||||||| ||||||||| |
|
|
| T |
19027947 |
gcgtatgtgggagctttagtgcaccgg |
19027973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 29208032 - 29207900
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
29208032 |
gaaaggtcacgggttcaagtcctggaaattgcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
29207934 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
29207933 |
catatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 48598959 - 48598827
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||| || |
|
|
| T |
48598959 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccatg |
48598861 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||| |||||| | ||||||||||||||||| |
|
|
| T |
48598860 |
catatgccggagctctagtgcaccgggttgccct |
48598827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 5306799 - 5306662
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||||||||| ||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
5306799 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatcagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
5306700 |
T |
 |
| Q |
227 |
cgtatg----cgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| |
|
|
| T |
5306699 |
cgtatgtggacgggagctttaatgcaccgggttgccct |
5306662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 47443956 - 47444090
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||| ||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
47443956 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccct |
47444055 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| ||||| ||||||| |||||| |||||||||| |
|
|
| T |
47444056 |
gcatatgcaggagcttcagtgcactgggttgccct |
47444090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 11054282 - 11054150
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||| ||||| || ||||||| |||||||||| |
|
|
| T |
11054282 |
gaaaggtcacgggttcaagtcctgaaaacagtctcttgtgtaaaac-agggtaagactgcgtacaatacaccaaatggcggaaccccttcccggaccctg |
11054184 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
11054183 |
catatgcgggagctctagtgcaccgggttgccct |
11054150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 47528664 - 47528532
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
47528664 |
gaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
47528566 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| ||||||| | ||||||||||||||||| |
|
|
| T |
47528565 |
aatatgtgggagctctagtgcaccgggttgccct |
47528532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 145 - 260
Target Start/End: Complemental strand, 20639777 - 20639660
Alignment:
| Q |
145 |
gtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20639777 |
gtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagcttt |
20639678 |
T |
 |
| Q |
243 |
ggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
20639677 |
agtgcaccgggttgccct |
20639660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 44363268 - 44363132
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||||| |||||||||||||||||| | || |||||||||| |||||| |||||||||||| |||| || |||||||||||||| ||||||| |
|
|
| T |
44363268 |
gaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcaccaaaaatggtgggaccccttcccggacc |
44363169 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44363168 |
ctgcgtatgcgggagctttagtgcaccgggttgccct |
44363132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 128 - 260
Target Start/End: Original strand, 16911562 - 16911697
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||| |||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
16911562 |
aaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccc |
16911661 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| ||||||||||| || ||||||||||||| |
|
|
| T |
16911662 |
tgcgtacgcgggagctttagtttaccgggttgccct |
16911697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 54175062 - 54175198
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctg-aaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacacc-gaatggtgggacccctt-gccggacc |
223 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
54175062 |
gaaatgtcacggattcaagtcctggaaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttccccggacc |
54175161 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| |||||||||||||| |||||||||| |||||| |
|
|
| T |
54175162 |
ctgcatatgcgggagctttagtgcaccgggctgccct |
54175198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 16408737 - 16408603
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| |||||||| |||||||||||||||| | ||||||| ||||||| |||||||| |
|
|
| T |
16408737 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaataatggtggaaccccttcccggacccc |
16408638 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||| |
|
|
| T |
16408637 |
gcatatgcgggagctttagtgcaccgggttgccct |
16408603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 129 - 259
Target Start/End: Original strand, 21646965 - 21647098
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||| ||||||||||||| ||||| | ||||||||||||| |||||||||||||||||||||| ||| | ||||||||||||||| || ||||| |
|
|
| T |
21646965 |
aaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaaggctgcgtacaatataccaataatggtgggaccccttcccagacccc |
21647064 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||| |
|
|
| T |
21647065 |
gcatatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 127 - 249
Target Start/End: Complemental strand, 41018929 - 41018807
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||| |||||||||||| ||||||||||||| ||| |||||||||||| || |||| || |
|
|
| T |
41018929 |
gaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaattagggtaaggctacgtacaatacaccaaatagtgggaccccttcccagaccttg |
41018830 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
|||||| || ||||| |||||| |
|
|
| T |
41018829 |
cgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 243
Target Start/End: Original strand, 25463121 - 25463238
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata-gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||| ||| |||| ||||||||| ||||| |||||||||||||||| ||||||||| |
|
|
| T |
25463121 |
gaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccccttcccggaccct |
25463220 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttg |
243 |
Q |
| |
|
|| ||||||||||||||| |
|
|
| T |
25463221 |
gcatatgcgggagctttg |
25463238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 160 - 260
Target Start/End: Original strand, 25629081 - 25629182
Alignment:
| Q |
160 |
tcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||| |||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
25629081 |
tcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgcc |
25629180 |
T |
 |
| Q |
259 |
ct |
260 |
Q |
| |
|
|| |
|
|
| T |
25629181 |
ct |
25629182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 17043530 - 17043414
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | |||||||||||| | ||||||||||||||||||||||||| |||||||||||||||| || |||||| |
|
|
| T |
17043530 |
gaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccagaccct |
17043431 |
T |
 |
| Q |
226 |
gcgtatgcgggagcttt |
242 |
Q |
| |
|
|| ||||| |||||||| |
|
|
| T |
17043430 |
gcatatgctggagcttt |
17043414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 127 - 258
Target Start/End: Complemental strand, 39077930 - 39077800
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||||||||| ||||||||||| ||| ||||||| ||| ||| |||||||||| |
|
|
| T |
39077930 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggttgcgtacaatataccaaatggtgagacatctttccggaccctg |
39077832 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
| |||||||||||| | ||||||||||||||| |
|
|
| T |
39077831 |
catatgcgggagctctagtgcaccgggttgcc |
39077800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 130 - 260
Target Start/End: Complemental strand, 32478918 - 32478794
Alignment:
| Q |
130 |
aggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgt |
229 |
Q |
| |
|
||||||| ||||||||||||| ||||||| ||| ||||||||| |||||||||||| |||||||| |||||||||||||||| |||||||| |||| |
|
|
| T |
32478918 |
aggtcacaggttcaagtcctggaaacaacctctagtgtaaaaacagggtaaggctg-----aatacaccaaatggtgggaccccttcccggacccagcgt |
32478824 |
T |
 |
| Q |
230 |
atgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| |
|
|
| T |
32478823 |
atgcgggagcttt-gtgcaccgggtggccct |
32478794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 35567169 - 35567303
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| ||||||||||| || ||||| | |||||||||||| |||||||||||| |||||| ||||| |||||||||||||||| ||| ||||| |
|
|
| T |
35567169 |
gaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaatggtgggaccccttcccgaaccct |
35567268 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| |||||||||||| |||||||||| |||||| |
|
|
| T |
35567269 |
gcgtctgcgggagctttagtgcaccgggctgccct |
35567303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 127 - 248
Target Start/End: Original strand, 37494850 - 37494972
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||||||||| ||||||||| ||| ||||||| ||| |||||||||||||||| | ||||||| |
|
|
| T |
37494850 |
gaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggttgcatacaatataccaaatggtgggacccctttcgggaccct |
37494949 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgca |
248 |
Q |
| |
|
|||||||| |||||||| ||||| |
|
|
| T |
37494950 |
gcgtatgcaggagctttagtgca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 7909383 - 7909282
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgc-gggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||| ||| ||||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
7909383 |
tcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttgcc |
7909284 |
T |
 |
| Q |
259 |
ct |
260 |
Q |
| |
|
|| |
|
|
| T |
7909283 |
ct |
7909282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 14983835 - 14983967
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||| |||||||| | ||||| | |||||||||||| ||||||||||| ||| |||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
14983835 |
aaggtcacggattcaagtctttgaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatggtgggaccccttcccggaccctgc |
14983934 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||| |
|
|
| T |
14983935 |
gtatgcgggagctttagtgtaccatgttgccct |
14983967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 30690319 - 30690178
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat--------agggtaaggctgcgtacaatacaccgaatggtgggaccccttgcc |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||| | | ||||||||||||| ||||||||||||| ||||||||||| | |||||||||||||| || |
|
|
| T |
30690319 |
gaaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttccc |
30690220 |
T |
 |
| Q |
219 |
ggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || |||||| |
|
|
| T |
30690219 |
ggaccctgcgtatgcgggagctttagtgcaccaggctgccct |
30690178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 140 - 258
Target Start/End: Complemental strand, 9987957 - 9987838
Alignment:
| Q |
140 |
ttcaagtcctgaaaacaacatcttgtgtaaa-aatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggag |
238 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||| | |||| ||| |||||||||| |
|
|
| T |
9987957 |
ttcaagtcctggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggag |
9987858 |
T |
 |
| Q |
239 |
ctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||| ||||||||| |||| |
|
|
| T |
9987857 |
ctttaatgcaccgggctgcc |
9987838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 23501792 - 23501922
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||||||||||||||| ||| | ||||||||||||| ||||||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
23501792 |
gaaaggtcacgggttcaagtc------acagcctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggacc |
23501885 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
23501886 |
ctgcatatgcgggagctttagtgcaccgggttgccct |
23501922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 128 - 251
Target Start/End: Original strand, 54730249 - 54730376
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa--tagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| |||| |||||||||||| |||||||| | ||| ||| ||||||| ||||||| |
|
|
| T |
54730249 |
aaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaataggataaggctgcgtataatacaccaataatgatggaaccccttcccggacc |
54730348 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccg |
251 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
54730349 |
ctgcgtatgcgggagctttagtgcaccg |
54730376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 136 - 260
Target Start/End: Complemental strand, 8473747 - 8473622
Alignment:
| Q |
136 |
cgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggacccctt-gccgga-ccctgcgtatgc |
233 |
Q |
| |
|
||||||||||||||| ||||| | |||||||| || ||||||||||||| ||||||||||| |||||||||||||||| ||||| |||||| ||||| |
|
|
| T |
8473747 |
cgggttcaagtcctggaaacagcctcttgtgtttaac-agggtaaggctgcatacaatacaccaaatggtgggaccccttccccggacccctgcatatgc |
8473649 |
T |
 |
| Q |
234 |
gggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
8473648 |
gggagctttagtgcaccgggttgccct |
8473622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 239
Target Start/End: Complemental strand, 7385612 - 7385499
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||||||||||||| |||| ||||| | || |||||||||| |||||||||| || || ||||||||| ||||||||||||| || ||||||||| |
|
|
| T |
7385612 |
gaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtgggaccctttcccggaccct |
7385513 |
T |
 |
| Q |
226 |
gcgtatgcgggagc |
239 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
7385512 |
gtgtatgcgggagc |
7385499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 174 - 260
Target Start/End: Original strand, 20225121 - 20225209
Alignment:
| Q |
174 |
agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
20225121 |
agggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
20225209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 160 - 241
Target Start/End: Original strand, 49796830 - 49796911
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctt |
241 |
Q |
| |
|
|||||||| |||| | ||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
49796830 |
tcttgtgttaaaacatggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 160 - 252
Target Start/End: Complemental strand, 51865141 - 51865048
Alignment:
| Q |
160 |
tcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
51865141 |
tcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccgg |
51865048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 55766568 - 55766468
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| ||||||||| ||||| | ||||||| |||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
55766568 |
tcttgtgtgtaaacagggtaaggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgccc |
55766469 |
T |
 |
| Q |
260 |
t |
260 |
Q |
| |
|
| |
|
|
| T |
55766468 |
t |
55766468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 11394925 - 11394985
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11394925 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
11394985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 11404652 - 11404712
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11404652 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
11404712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 200 - 260
Target Start/End: Complemental strand, 38755970 - 38755910
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38755970 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
38755910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 7038052 - 7038185
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | |||||||| |||||||||||||| || ||||||||||||| ||||||||| | ||| |||||||| |
|
|
| T |
7038052 |
gaaaggtcacaggttcaagtcctg-aaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaaaatggtggggcacctacccggaccc |
7038150 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||| | |||||||| |||||| |||||||||| |
|
|
| T |
7038151 |
tgcgtatac-ggagctttagtgcactgggttgccct |
7038185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 140 - 257
Target Start/End: Original strand, 21489099 - 21489218
Alignment:
| Q |
140 |
ttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcggga |
237 |
Q |
| |
|
||||||||||| ||||| | ||||| ||||||| || ||||| ||||||||||| |||| || |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
21489099 |
ttcaagtcctggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcggga |
21489198 |
T |
 |
| Q |
238 |
gctttggtgcaccgggttgc |
257 |
Q |
| |
|
||||| |||||| ||||||| |
|
|
| T |
21489199 |
gctttcgtgcactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 176 - 249
Target Start/End: Complemental strand, 20908723 - 20908649
Alignment:
| Q |
176 |
ggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
20908723 |
ggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
20908649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 177 - 260
Target Start/End: Complemental strand, 30352667 - 30352582
Alignment:
| Q |
177 |
gtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| ||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
30352667 |
gtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccct |
30352582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 30581602 - 30581485
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgta--aaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||| ||||||||||| || ||||||| ||||||||| |||| ||||||||| || |||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
30581602 |
aaaggtcaagggttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaatggtgggaccccttcccggaccc |
30581503 |
T |
 |
| Q |
225 |
tgcgtatgcgggagcttt |
242 |
Q |
| |
|
||| |||| |||||||| |
|
|
| T |
30581502 |
tgcatatgtaggagcttt |
30581485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 47441666 - 47441540
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| ||||||||||| ||||| |||| ||||||||| |||||||||||| |||||||||||| |||||| ||||||||| ||||||||| |
|
|
| T |
47441666 |
gaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaatggttggaccccttcccggaccct |
47441567 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
| ||| || |||||||| || |||||| |
|
|
| T |
47441566 |
gagtaagcaggagctttcgtccaccgg |
47441540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 191 - 260
Target Start/End: Original strand, 38786673 - 38786742
Alignment:
| Q |
191 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
38786673 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
38786742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 259
Target Start/End: Original strand, 54967020 - 54967151
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| |||||||| ||| ||| ||| ||||||||||||| ||||||||| ||| ||||||| ||| |||||||||||||||| ||| ||||| |
|
|
| T |
54967020 |
gaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaaggttgc-tacaatataccaaatggtgggaccccttcccgtaccct |
54967118 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
| |||||||||||||| |||||||||| ||||| |
|
|
| T |
54967119 |
acatatgcgggagcttt-gtgcaccgggctgccc |
54967151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 132 - 260
Target Start/End: Complemental strand, 10277886 - 10277759
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
231 |
Q |
| |
|
||||||||||||| |||| ||||| | |||||| ||||| |||| ||||||||||||||||||||| ||||||| ||||||| || |||||||| ||| |
|
|
| T |
10277886 |
gtcacgggttcaaatccttgaaacagcctcttgtataaaa-taggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatat |
10277788 |
T |
 |
| Q |
232 |
gcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||| | | ||| ||||| ||||||| |
|
|
| T |
10277787 |
gcgggagttctagtgaaccggattgccct |
10277759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 13256504 - 13256401
Alignment:
| Q |
160 |
tcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| | || |||||||||||| ||| |||| || | |||||||||||| ||||||||||||| |
|
|
| T |
13256504 |
tcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttg |
13256405 |
T |
 |
| Q |
257 |
ccct |
260 |
Q |
| |
|
|||| |
|
|
| T |
13256404 |
ccct |
13256401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 127 - 251
Target Start/End: Complemental strand, 30496456 - 30496333
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||| ||||||||| || ||||| | ||||||||||| | |||||||||||| ||||||||||| ||||| ||||| |||| ||||||| || |
|
|
| T |
30496456 |
gaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaacac-gggtaaggctgcatacaatacaccaaatggggggactccttcccggaccgtg |
30496358 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccg |
251 |
Q |
| |
|
| |||| |||||||| |||||||| |
|
|
| T |
30496357 |
cttatgatggagctttagtgcaccg |
30496333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 200 - 260
Target Start/End: Complemental strand, 33836549 - 33836489
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
33836549 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccct |
33836489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 55830823 - 55830723
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|||||||| ||| ||||||| |||||||||||||||| ||||||||| ||||| | ||||||| |||||||||| ||||||| ||||||| || ||||| |
|
|
| T |
55830823 |
tcttgtgtgtaaacagggtaatgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgccc |
55830724 |
T |
 |
| Q |
260 |
t |
260 |
Q |
| |
|
| |
|
|
| T |
55830723 |
t |
55830723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 152 - 260
Target Start/End: Complemental strand, 12711561 - 12711451
Alignment:
| Q |
152 |
aaacaacatcttgtgtaaaaa--tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| ||||| |||||||||| | |||| |||||||||| | |||| |||||| |
|
|
| T |
12711561 |
aaacaacatcttgtgtaaaaaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcac |
12711462 |
T |
 |
| Q |
250 |
cgggttgccct |
260 |
Q |
| |
|
| |||||||| |
|
|
| T |
12711461 |
ccagttgccct |
12711451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 201 - 260
Target Start/End: Original strand, 32484307 - 32484366
Alignment:
| Q |
201 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
32484366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 201 - 260
Target Start/End: Complemental strand, 40553998 - 40553939
Alignment:
| Q |
201 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
40553939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 49938726 - 49938613
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | ||||||||||||| ||||||| | |||||||||||| |||||||||||||||| || ||||| |
|
|
| T |
49938726 |
gaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacggggtaag---gtgtacaatacaccaaaatggtgggaccccttcccataccct |
49938630 |
T |
 |
| Q |
226 |
gcgtatgcgggagcttt |
242 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
49938629 |
gcatatgcgggagcttt |
49938613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 25388249 - 25388309
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
25388249 |
aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgccct |
25388309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 128 - 242
Target Start/End: Complemental strand, 39029196 - 39029080
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||| |||||||| | || ||||| | ||||||||||||| |||||||||||| ||||||||||| || |||||||||| ||| ||||||||| |
|
|
| T |
39029196 |
aaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaatggtgggaccactttccggaccct |
39029097 |
T |
 |
| Q |
226 |
gcgtatgcgggagcttt |
242 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
39029096 |
gcatatgcgggagcttt |
39029080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 187
Target Start/End: Complemental strand, 42164284 - 42164224
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcg |
187 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
42164284 |
gaaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaacagggtaaggctgcg |
42164224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 248
Target Start/End: Complemental strand, 47482912 - 47482864
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
248 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47482912 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgca |
47482864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 139 - 259
Target Start/End: Original strand, 10660415 - 10660538
Alignment:
| Q |
139 |
gttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgg |
235 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||| |||||||| |||||| ||||||||||| ||||||| |||||||| | || ||||||||||||| |
|
|
| T |
10660415 |
gttcaagtcctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgg |
10660513 |
T |
 |
| Q |
236 |
gagcttt-ggtgcaccgggttgccc |
259 |
Q |
| |
|
||||||| ||||| |||||||||| |
|
|
| T |
10660514 |
gagctttaagtgcatcgggttgccc |
10660538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 139 - 259
Target Start/End: Original strand, 10874560 - 10874683
Alignment:
| Q |
139 |
gttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgg |
235 |
Q |
| |
|
|||||||||||| ||||||| |||| ||||||| |||||||| |||||| ||||||||||| ||||||| |||||||| | || ||||||||||||| |
|
|
| T |
10874560 |
gttcaagtcctggaaacaacctcttatgtaaaaaatagggtatggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgg |
10874658 |
T |
 |
| Q |
236 |
gagcttt-ggtgcaccgggttgccc |
259 |
Q |
| |
|
||||||| ||||| |||||||||| |
|
|
| T |
10874659 |
gagctttaagtgcatcgggttgccc |
10874683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 168 - 260
Target Start/End: Complemental strand, 36816479 - 36816386
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaat-ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||| | |||||||||||||||||| || |||||||| |||| | |||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
36816479 |
aaaaacagggcagggctgcgtacaatacaccaaaaaggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccct |
36816386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 127 - 253
Target Start/End: Complemental strand, 487271 - 487135
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacac---------cgaatggtgggaccccttg |
216 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||| |||| | ||||| |||||||||||||||| | |||| |||||||||| |
|
|
| T |
487271 |
gaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaaatggtgggatggcgggaccccttc |
487172 |
T |
 |
| Q |
217 |
ccggaccctgcgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
487171 |
ccggattctgcgaatgcgggagctttagtgcaccggg |
487135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 212 - 260
Target Start/End: Original strand, 35532077 - 35532125
Alignment:
| Q |
212 |
ccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
35532125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 169 - 243
Target Start/End: Original strand, 9037772 - 9037847
Alignment:
| Q |
169 |
aaaatagggtaaggctgcgtacaatacaccgaatggtgggacccc-ttgccggaccctgcgtatgcgggagctttg |
243 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| ||||||| || ||| || |||||||||| ||||||||| |
|
|
| T |
9037772 |
aaaatagggtaagactgcatacaatacaccgaatggtaggaccccttttccgaacactgcgtatgcaggagctttg |
9037847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 168 - 260
Target Start/End: Original strand, 20405128 - 20405222
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||||||| |||||||||||||| | ||||||||||||||| |||||||| || |||||||||||||| ||||| |||||||||| |
|
|
| T |
20405128 |
aaaaacagggtaagattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgccct |
20405222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 138 - 259
Target Start/End: Original strand, 36589753 - 36589876
Alignment:
| Q |
138 |
ggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgg |
235 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||||| | ||||| |||| ||| |||||| || |||||||||||||| | | ||||| |||||||| |
|
|
| T |
36589753 |
ggttcaagtcctggaaacagcctcttgtgtaaaaaacatggtaatgctgttgacagtacaccaaaatggtgggaccccttcctgaaccctatgtatgcgg |
36589852 |
T |
 |
| Q |
236 |
gagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
36589853 |
gagctttggtgcaccgggctgccc |
36589876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 201 - 260
Target Start/End: Original strand, 44718641 - 44718700
Alignment:
| Q |
201 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgccct |
44718700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 208
Target Start/End: Complemental strand, 10380078 - 10379997
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtggg |
208 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| ||||||||||||||||| ||| ||||||||||||||| ||| ||||| |
|
|
| T |
10380078 |
gaaaggtcacttgttcaagtcctacaaacaacctcttgtgtaaaaataggataaaattgcgtacaatacaccaaatagtggg |
10379997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 160 - 243
Target Start/End: Complemental strand, 3580943 - 3580859
Alignment:
| Q |
160 |
tcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
243 |
Q |
| |
|
||||||||||||| | |||||||||| || ||||||||| |||| | ||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
3580943 |
tcttgtgtaaaaaccatggtaaggctgtgtgcaatacaccaaatgctaggaccccttcccggaccctgcatatgtgggagctttg |
3580859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 137 - 212
Target Start/End: Complemental strand, 17079777 - 17079701
Alignment:
| Q |
137 |
gggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccc |
212 |
Q |
| |
|
||||||||||| || |||||| |||||||||| |||| ||||||||||||| |||||||| | ||||||||||||| |
|
|
| T |
17079777 |
gggttcaagtcttggaaacaatatcttgtgtataaaacagggtaaggctgcatacaatacgctaaatggtgggaccc |
17079701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 127 - 238
Target Start/End: Complemental strand, 32629404 - 32629293
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||| |||| ||||| | |||||| ||||| |||||||||| || ||| ||||||| || ||| |||||||||| ||||||| | |
|
|
| T |
32629404 |
gaaaggtcacgggttcaaatcctcgaaacagcctcttgtaaaaaaacagggtaaggccgcctac-atacaccaaattggcgggaccccttcccggacctt |
32629306 |
T |
 |
| Q |
226 |
gcgtatgcgggag |
238 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
32629305 |
gcgtatgtgggag |
32629293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 260
Target Start/End: Complemental strand, 50555718 - 50555658
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||| ||| |||||||||| |||||| |
|
|
| T |
50555718 |
aatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgccct |
50555658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 205 - 260
Target Start/End: Complemental strand, 12666914 - 12666859
Alignment:
| Q |
205 |
tgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||| |||||| ||||||||| |||||||| || |||||||||||||| |
|
|
| T |
12666914 |
tgggaccccttgtcggaccatgcgtatgcaggagctttagtacaccgggttgccct |
12666859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 14590836 - 14590922
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaatggtgggacc |
211 |
Q |
| |
|
|||||||||||| |||||||||| ||||| | |||||| |||||| | |||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
14590836 |
gaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacc |
14590922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 186
Target Start/End: Complemental strand, 17315434 - 17315375
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgc |
186 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| ||||||||||||| | ||||||||||| |
|
|
| T |
17315434 |
gaaaggtcacgggttcaattcctcgaaacaacctcttgtgtaaaaacaaggtaaggctgc |
17315375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 246
Target Start/End: Complemental strand, 23914452 - 23914342
Alignment:
| Q |
135 |
acgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatg |
232 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||| |||| ||||||||| | | ||||||||| ||||| | | |||||||||| |
|
|
| T |
23914452 |
acggattcaagtcctgaaaacg---tcttgtgtaaaaatagggtaagactgcatacaatacatcaaatatggtgggatcccttcatgaatcctgcgtatg |
23914356 |
T |
 |
| Q |
233 |
cgggagctttggtg |
246 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
23914355 |
tgagagctttggtg |
23914342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 186
Target Start/End: Original strand, 43035247 - 43035307
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaa-aaatagggtaaggctgc |
186 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||||||| ||| | ||||||||||| |
|
|
| T |
43035247 |
gaaaggtcacgggttcaagtccaggaaacaacctcttgtgtaagaaacacggtaaggctgc |
43035307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 169 - 253
Target Start/End: Original strand, 16494259 - 16494345
Alignment:
| Q |
169 |
aaaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|||| ||||||| ||||| ||||||||||| || ||||||||||| || || ||||||| |||||||| |||||| ||| |||||| |
|
|
| T |
16494259 |
aaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg |
16494345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 140 - 198
Target Start/End: Original strand, 51420586 - 51420645
Alignment:
| Q |
140 |
ttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacacc |
198 |
Q |
| |
|
|||||||| || ||||||| ||||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
51420586 |
ttcaagtcatggaaacaacctcttgtgtagaaaacagggtaaggctgggtacaatacacc |
51420645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 260
Target Start/End: Original strand, 2813172 - 2813261
Alignment:
| Q |
174 |
agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagcttt-ggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| |||||||||||||| | | |||||||||||| || ||| || |||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
2813172 |
agggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgccct |
2813261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 202 - 260
Target Start/End: Original strand, 19027986 - 19028044
Alignment:
| Q |
202 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||| |||| |||||||| | |||||||||||||| |||||||||| |||||| |
|
|
| T |
19027986 |
tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgccct |
19028044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 200 - 258
Target Start/End: Original strand, 28494224 - 28494282
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||||||| || || ||||| |||||||||||| | |||||||||| |||| |
|
|
| T |
28494224 |
aatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgcc |
28494282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 130 - 198
Target Start/End: Original strand, 25343189 - 25343258
Alignment:
| Q |
130 |
aggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacacc |
198 |
Q |
| |
|
||||||| ||||||||| ||| ||| | ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25343189 |
aggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacacc |
25343258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 54640475 - 54640430
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa |
172 |
Q |
| |
|
||||||||||||||||||||| || ||||| | ||||||||||||| |
|
|
| T |
54640475 |
gaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaa |
54640430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 260
Target Start/End: Original strand, 56322984 - 56323033
Alignment:
| Q |
211 |
cccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
56322984 |
cccttcccggaccccggatatgcgggagctttagtgcaccgggttgccct |
56323033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 200 - 248
Target Start/End: Original strand, 8820581 - 8820629
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
248 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| ||| ||| ||||| |
|
|
| T |
8820581 |
aatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgca |
8820629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 171
Target Start/End: Original strand, 41549381 - 41549425
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa |
171 |
Q |
| |
|
|||| ||||||||||||||| ||| ||||||| |||||||||||| |
|
|
| T |
41549381 |
gaaatgtcacgggttcaagttctggaaacaacctcttgtgtaaaa |
41549425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 48327868 - 48327765
Alignment:
| Q |
160 |
tcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
||||||||||||| |||||||| |||| ||||||||||| | ||||||||||| ||| ||| |||| | ||||||| || ||| |||||||||||| |
|
|
| T |
48327868 |
tcttgtgtaaaaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgggtta |
48327769 |
T |
 |
| Q |
257 |
ccct |
260 |
Q |
| |
|
|||| |
|
|
| T |
48327768 |
ccct |
48327765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 96; Significance: 5e-47; HSPs: 81)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 129 - 259
Target Start/End: Original strand, 46991828 - 46991959
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46991828 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgc |
46991927 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| |
|
|
| T |
46991928 |
gtatgtgggagctttagtgcaccgggttgccc |
46991959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 129 - 258
Target Start/End: Original strand, 6925124 - 6925254
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||| | | |||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
6925124 |
aaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccgaatggtgggaccccttcccggtccctgc |
6925223 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||||||||||| |||||||| |||||| |
|
|
| T |
6925224 |
gtatgcgggagctttagtgcaccgagttgcc |
6925254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 34725232 - 34725100
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
34725232 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacactaaatggtgggaccccttcccggaccctg |
34725134 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
34725133 |
catatgcgggagctctagtgcaccgggttgccct |
34725100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 46248089 - 46247955
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||| |||||||||||||||| || ||||| | ||||||||||||| |||||||| |||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
46248089 |
gaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccggaccct |
46247990 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
46247989 |
gcgtatgcgggagctttagtgtaccgggttgccct |
46247955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 27474303 - 27474436
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| |||||||||| || ||||| ||||||||||||| |||| || |||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
27474303 |
gaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaacagggcaaagctgcgtacaatacactgaatggtgggaccccttcccggaccctg |
27474402 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||| |
|
|
| T |
27474403 |
cgtatgcgggagctttagtgcaccggattgccct |
27474436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 32632692 - 32632559
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| || |||||| |
|
|
| T |
32632692 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccaaaccctg |
32632593 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||||||||||| ||||||| |||| |||| |
|
|
| T |
32632592 |
catatgcgggagcttgagtgcaccaggtttccct |
32632559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 35005145 - 35005281
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||||||||||||||| |||||||| | ||||||||||||| ||||||||||||| ||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
35005145 |
gaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggacc |
35005244 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
35005245 |
ctgcgtatgcgggcgctttagtgcaccgggttgccct |
35005281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 127 - 243
Target Start/End: Original strand, 11596535 - 11596651
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||| |||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||| |||||||| |||||||||||||||| | |||||||| |
|
|
| T |
11596535 |
gaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaaacagggtaaggctgcgtataatacaccaaatggtgggaccccttcctggaccctg |
11596634 |
T |
 |
| Q |
227 |
cgtatgcgggagctttg |
243 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
11596635 |
cgtatgcgggagctttg |
11596651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 10668247 - 10668383
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| | ||||||| ||||||||||||||| | ||||||||||||||| |||| || |
|
|
| T |
10668247 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtcc |
10668346 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10668347 |
ctgcgtatgcgggagctttagtgcaccgggttgccct |
10668383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 35253321 - 35253189
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||| ||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
35253321 |
gaaagatcacgggttcaagtcctcgaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
35253223 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||| ||||||| |
|
|
| T |
35253222 |
catatgcgggagctctagtgcaccggattgccct |
35253189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 38478416 - 38478284
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||| ||||||| ||||||||| |
|
|
| T |
38478416 |
gaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtggaaccccttctcggaccctg |
38478318 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
38478317 |
catatgcgggagctctagtgcaccgggttgccct |
38478284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 168 - 260
Target Start/End: Original strand, 4349702 - 4349794
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4349702 |
aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
4349794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 30395862 - 30395728
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
30395862 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
30395763 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| |||||||| |||||||| |
|
|
| T |
30395762 |
gcatatgcgggagctttagtgcaccgagttgccct |
30395728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 14617060 - 14617194
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaa-aatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||||| |||||||||||| ||||| | ||||||||||| || | ||||||| ||||||||||||||| |||||||||| ||||| ||||||||| |
|
|
| T |
14617060 |
gaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggtaaggttgcgtacaatacaccaaatggtgggatcccttcccggaccct |
14617159 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| |||||||||||| |||| |
|
|
| T |
14617160 |
gcatatgcgggagctttagtgcaccgggttaccct |
14617194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 18944665 - 18944802
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||| |||||||| |||| ||||| | ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
18944665 |
gaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaacaatggtgggaccccttcccggacc |
18944764 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagc-tttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
18944765 |
ctgcgtatgcgggagcttttagtgcaccgggttgccct |
18944802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 129 - 259
Target Start/End: Original strand, 45402118 - 45402251
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggt--aagg-ctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||| |||||||||||||||| ||||| | ||||||||||||| ||||| ||| |||||||||||||||| |||||||||||||||| || |||||| |
|
|
| T |
45402118 |
aaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggttcaagttctgcgtacaatacaccaaatggtgggaccccttcccagaccct |
45402217 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
45402218 |
gcgtatgcgggagctttagtgcaccgggttgccc |
45402251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 127 - 258
Target Start/End: Complemental strand, 45812671 - 45812541
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||| |||||||||||||||| || |||||| |
|
|
| T |
45812671 |
gaaaggtcacaggttcaagtcctgaaaacagtctcttgtgtaaaag-agggtaaggctgcatacaatacaccaaatggtgggaccccttcccaaaccctg |
45812573 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
| |||||||||||| | ||||||||||||||| |
|
|
| T |
45812572 |
catatgcgggagctctagtgcaccgggttgcc |
45812541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 127 - 240
Target Start/End: Complemental strand, 25468399 - 25468285
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| |||||||||||||| ||||||||| ||||||||||||||| |||||| ||||| ||| || |||||| |
|
|
| T |
25468399 |
gaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatggttggacctcttcccagaccct |
25468300 |
T |
 |
| Q |
226 |
gcgtatgcgggagct |
240 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25468299 |
gcgtatgcgggagct |
25468285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 12126971 - 12126839
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||| |||| ||| ||||| | |||||||||||| ||||||||||||||||||||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
12126971 |
gaaaggtcacgggtttaagttctggaaacagcttcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaattgtgggaccccttcccggaccctg |
12126873 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | |||||| | |||||||| |
|
|
| T |
12126872 |
catatgcgggagctgtagtgcactgcgttgccct |
12126839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 19414461 - 19414593
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||||||||| ||| | | |||| ||||||| ||| ||||||||||||||||||||| |||||||||||||||| ||| |||||| |
|
|
| T |
19414461 |
gaaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaac-aggttaaggctgcgtacaatacaccaaatggtgggaccccttcccgtaccctg |
19414559 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
19414560 |
catatgcgggagctctagtgcaccgggttgccct |
19414593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 129 - 257
Target Start/End: Complemental strand, 23768454 - 23768325
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||| |||||||||| || ||||| | ||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||| || |||||||| |
|
|
| T |
23768454 |
aaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggacaccttcccagaccctgc |
23768355 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgc |
257 |
Q |
| |
|
||||||||||||||| ||||| ||| |||| |
|
|
| T |
23768354 |
gtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 27201669 - 27201805
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaa-aaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||| |||||||||||||| ||||| | |||||||| | ||| ||||||||||||||||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
27201669 |
gaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggacc |
27201768 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| |
|
|
| T |
27201769 |
ttgcgtatgcgggagctttagtgcattgggttgccct |
27201805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 2435923 - 2435796
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | || ||||| |||||||||||||| |||||||||||||||| || |||||||||||||| ||| |||| |
|
|
| T |
2435923 |
gaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaaaatggtgggacccctttccgtaccc |
2435824 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
| || ||||||||||||| ||||||||| |
|
|
| T |
2435823 |
tccgcatgcgggagctttagtgcaccgg |
2435796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 20004226 - 20004092
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||| ||||||||| | ||||||||||||||||||||||| | ||||||||||||||| || ||||| |
|
|
| T |
20004226 |
aaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacccc |
20004127 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||| |
|
|
| T |
20004126 |
gcatatgcgggagctttagtgcaccgggttgccct |
20004092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 146 - 260
Target Start/End: Complemental strand, 31382330 - 31382216
Alignment:
| Q |
146 |
tcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggt |
245 |
Q |
| |
|
||||| ||||| | ||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||| | ||||||||| |||||||||||||| | |
|
|
| T |
31382330 |
tcctggaaacagcctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttact |
31382231 |
T |
 |
| Q |
246 |
gcaccgggttgccct |
260 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
31382230 |
gtaccgggttgccct |
31382216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 6983945 - 6983813
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | || | | ||||| |||||||| ||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
6983945 |
gaaaggtcacaggttcaagtcctggaaacagcctcgtata-aaaaacagggtaagtatgcgtacaatacaccaaatggtgggacccctttccggaccctg |
6983847 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| || ||||||||||||||||||| |||||| |
|
|
| T |
6983846 |
cgtaggcaggagctttggtgcaccgggctgccct |
6983813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 127 - 243
Target Start/End: Complemental strand, 18724681 - 18724564
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| |||||||||||| |||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
18724681 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaatcttgggaccccttcccggaccct |
18724582 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttg |
243 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
18724581 |
acatatgcgggagctttg |
18724564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 127 - 253
Target Start/End: Complemental strand, 44485245 - 44485119
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||||| | | ||||||||||||||||||||||| |||||| ||||||||| ||||| ||| |
|
|
| T |
44485245 |
gaaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacaccaaatggttggaccccttcccggatcct |
44485146 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|||||||||||||||| |||||||||| |
|
|
| T |
44485145 |
acgtatgcgggagcttt-gtgcaccggg |
44485119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 47214533 - 47214655
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||| ||||| ||||||||| ||||||||||||||| |||||||||||||||| || ||||||| |
|
|
| T |
47214533 |
gaaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccagaccctg |
47214631 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
| |||||||||||| | ||||||| |
|
|
| T |
47214632 |
catatgcgggagctctagtgcacc |
47214655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 127 - 253
Target Start/End: Complemental strand, 35117904 - 35117774
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||| | | |||||||||||| | |||||||||||| |||||||||||| |||| ||||||||||| ||||||| |
|
|
| T |
35117904 |
gaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaaatgatgggaccccttcccggacc |
35117805 |
T |
 |
| Q |
224 |
ctgcgt-atgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|||||| |||| |||||||| |||||||||| |
|
|
| T |
35117804 |
ctgcgtaatgcaggagctttagtgcaccggg |
35117774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 9939483 - 9939620
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaa-aaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgc-cggac |
222 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||| ||| ||| | ||||||| ||||| ||||||||| || |||||||||||| | | ||||| |
|
|
| T |
9939483 |
gaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatggtgggacccccttctcggac |
9939582 |
T |
 |
| Q |
223 |
cctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
9939583 |
cctgcgtatgcgggagctttagtgcaccgggttaccct |
9939620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 169 - 259
Target Start/End: Complemental strand, 10378828 - 10378738
Alignment:
| Q |
169 |
aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||||| |||||||||| ||||| |
|
|
| T |
10378828 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 41319942 - 41319808
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| |||| |||||||| ||||| ||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||| ||| ||||| |
|
|
| T |
41319942 |
gaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatgatgggaccccttcccgaaccct |
41319843 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||| || |||||| |||||||||| |
|
|
| T |
41319842 |
tcatatgcgggagtttcagtgcactgggttgccct |
41319808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 253
Target Start/End: Original strand, 20036242 - 20036369
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||| | | ||||||| ||||| ||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
20036242 |
gaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacaccaaatggtggaaccccttcccggaccc |
20036341 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
||||||||| |||| ||| |||||||||| |
|
|
| T |
20036342 |
tgcgtatgcaggag-ttttgtgcaccggg |
20036369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 127 - 258
Target Start/End: Original strand, 35019252 - 35019383
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| | ||||||||||| ||||||| |||||| ||||||| || ||||||||| ||||||||||| | |||||||||||| | || |||||| |
|
|
| T |
35019252 |
gaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaattggtgggacccc-tcccagaccct |
35019350 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||||| ||||||| |||||||||| |||| |
|
|
| T |
35019351 |
gcgtatgcgagagctttagtgcaccgggctgcc |
35019383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 168 - 260
Target Start/End: Complemental strand, 18742053 - 18741959
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| ||||||||||||||||||||||||| || |||||||||||||| || ||||||||||||||| ||||||| |||||||||||| |||| |
|
|
| T |
18742053 |
aaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttccct |
18741959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 178 - 260
Target Start/End: Complemental strand, 1517395 - 1517313
Alignment:
| Q |
178 |
taaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||| | |||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
1517395 |
taaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccct |
1517313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 8197065 - 8197199
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| || | ||||||||||||| | ||||||||| |||||| |||||| |||||| ||||||||| |||||||| |
|
|
| T |
8197065 |
gaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggtaaggctacgtacagtacaccaaatggtaggaccccttctcggaccct |
8197164 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
8197165 |
gcgtatgttggagctttagtgtaccgggttgccct |
8197199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 31272510 - 31272383
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||||||||| | |||||||||||||||| ||| | ||||||||| | |||||||||| |
|
|
| T |
31272510 |
gaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacatggtaaggctgcgtacagcacatcaaatggtggg------ttccggaccctg |
31272417 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||| || ||| |||||| |
|
|
| T |
31272416 |
cgtatgcgggagctttagtggactgggctgccct |
31272383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 174 - 243
Target Start/End: Original strand, 15505634 - 15505703
Alignment:
| Q |
174 |
agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
243 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15505634 |
agggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttg |
15505703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 19701592 - 19701717
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatag-ggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||| |||||||||| ||||| |||||||| | ||||||||||||| ||||||| || |||||||||||| || ||||||| |||||| |||||||| |
|
|
| T |
19701592 |
gaaatgtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaatggtggggccccttcccggaccc |
19701691 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
|||||||||||||||||| ||||||| |
|
|
| T |
19701692 |
tgcgtatgcgggagctttagtgcacc |
19701717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 168 - 255
Target Start/End: Complemental strand, 31442484 - 31442396
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggtt |
255 |
Q |
| |
|
||||| ||||||||| ||||||||||||||| || |||||||||||||| |||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
31442484 |
aaaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgggagctttggtgcaccgggtt |
31442396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 137 - 261
Target Start/End: Original strand, 22324925 - 22325050
Alignment:
| Q |
137 |
gggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcg |
234 |
Q |
| |
|
||||||||||| || ||||| | ||||||||||||| ||||||||||||| ||||||||||| |||||||| |||| | || ||||||||||||||| |
|
|
| T |
22324925 |
gggttcaagtcttggaaacagcctcttgtgtaaaaacagggtaaggctgcatacaatacaccaaaaatggtggagccccgt-cccgaccctgcgtatgcg |
22325023 |
T |
 |
| Q |
235 |
ggagctttggtgcaccgggttgccctg |
261 |
Q |
| |
|
|||||||| ||||||| || ||||||| |
|
|
| T |
22325024 |
ggagctttagtgcaccaggctgccctg |
22325050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 168 - 260
Target Start/End: Complemental strand, 42304303 - 42304209
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| ||||||||| |||||||||||||| || |||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
42304303 |
aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccct |
42304209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 19974210 - 19974076
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||| ||||||||||||||| || ||||| | || |||||||||||||| |||| ||||||||||||||| |||| |||||||| || |||||| || |
|
|
| T |
19974210 |
gaaagatcacgggttcaagtcttggaaacagcctcaagtgtaaaaatagggcaaggttgcgtacaatacaccaaaatgatgggacccattcccggactct |
19974111 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||| |
|
|
| T |
19974110 |
atgtatgcgggagctttagtgcacggggctgccct |
19974076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 127 - 253
Target Start/End: Original strand, 23371146 - 23371271
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||| ||||||| ||| |||| || |||||||||||| |||| ||||||||||| || ||||||| |
|
|
| T |
23371146 |
gaaaggtcacgggttcaagtcctagaaacagccacttgggtaaaaaacgggcaaggttgtgtacaatacaccaaatgctgggacccctt-ccagaccctg |
23371244 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|||||| || |||||| |||||||||| |
|
|
| T |
23371245 |
cgtatgtggtagctttagtgcaccggg |
23371271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 147 - 260
Target Start/End: Original strand, 23796507 - 23796621
Alignment:
| Q |
147 |
cctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggt |
245 |
Q |
| |
|
|||| ||||| | |||||||||||||| | |||||| ||||||||||||||| ||||||| |||||||| || |||||||| ||||| |||||||| || |
|
|
| T |
23796507 |
cctggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagt |
23796606 |
T |
 |
| Q |
246 |
gcaccgggttgccct |
260 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
23796607 |
gcaccgggctgccct |
23796621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 174 - 260
Target Start/End: Original strand, 43768209 - 43768295
Alignment:
| Q |
174 |
agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||||||||| | |||||||||||||| || |||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
43768209 |
agggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccct |
43768295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 250
Target Start/End: Complemental strand, 45264536 - 45264411
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| ||||||| ||||| || ||||||||| || ||||||||| || |||||||||||||| | ||||| |
|
|
| T |
45264536 |
gaaaggtcacatgttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagaccc |
45264437 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
||| |||||||||||||| ||||||| |
|
|
| T |
45264436 |
tgcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 127 - 227
Target Start/End: Complemental strand, 22930203 - 22930104
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||| |||||||||||||| ||||| | | ||||||||||| ||||||||| || | |||||||||| |||||||||||||||| | |||||||| |
|
|
| T |
22930203 |
gaaaggtcatgggttcaagtcctggaaacagccttttgtgtaaaaacagggtaaggttgtg-acaatacaccaaatggtgggaccccttcctggaccctg |
22930105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 50606499 - 50606559
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
50606499 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
50606559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 168 - 260
Target Start/End: Complemental strand, 19932849 - 19932755
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| ||||||||||||||||||||||||| || |||||||||||||| ||||||||||||||||| || | || ||||||| ||||||||| |
|
|
| T |
19932849 |
aaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct |
19932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 160 - 239
Target Start/End: Complemental strand, 21910751 - 21910673
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagc |
239 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| |||||||||||||||| ||| ||||| ||| ||||||||| |
|
|
| T |
21910751 |
tcttatgtaaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgt-tgcgggagc |
21910673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 136 - 243
Target Start/End: Original strand, 30682845 - 30682951
Alignment:
| Q |
136 |
cgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgg |
235 |
Q |
| |
|
||||||||| ||||||||| | | ||||||||||||| | |||||| || ||||| |||| | |||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
30682845 |
cgggttcaaatcctgaaaatagcctcttgtgtaaaaacaaggtaagattgtgtaca-tacaacaaatggtgggaccccttcccggaccgtgcgtatgcgg |
30682943 |
T |
 |
| Q |
236 |
gagctttg |
243 |
Q |
| |
|
|||||||| |
|
|
| T |
30682944 |
gagctttg |
30682951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 179 - 260
Target Start/End: Complemental strand, 20999933 - 20999852
Alignment:
| Q |
179 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||| | | |||||||||| ||||||||||| |||||||||| |||||| |
|
|
| T |
20999933 |
aaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgccct |
20999852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 50811961 - 50812096
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||| ||| |||||| ||||| | ||||||||||||| | |||||||| ||||||||||||||| || |||||| ||||||| ||| || |
|
|
| T |
50811961 |
gaaaggtcacggaatcatgtcctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaaaatggtgg-accccttcccgcgcc |
50812059 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
50812060 |
ctgcgtatgcgggagctttaatgcactgggctgccct |
50812096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 129 - 208
Target Start/End: Complemental strand, 4430160 - 4430080
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtggg |
208 |
Q |
| |
|
||||||||||||| ||||| |||||||| |||||||||||||| |||||||| |||||||||||||||| ||||||||| |
|
|
| T |
4430160 |
aaggtcacgggtttaagtcttgaaaacagtatcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtggg |
4430080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 258
Target Start/End: Original strand, 22327121 - 22327250
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| |||||||| ||||| |||||||||||| |||| || |||| ||||||||| || ||| || | |
|
|
| T |
22327121 |
gaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgtacgatgcaccaaaatggtggg----gttcccgaactc |
22327216 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||| |
|
|
| T |
22327217 |
tgtgtatgcgggagctttggtgcaccgggctgcc |
22327250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 168 - 239
Target Start/End: Complemental strand, 20982844 - 20982773
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagc |
239 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
20982844 |
aaaaatagggtaaggctgccaacaatacacctaatggtgggatctcttctcggaccctgcgtatgcgggagc |
20982773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 195 - 257
Target Start/End: Complemental strand, 4587630 - 4587568
Alignment:
| Q |
195 |
caccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgc |
257 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
4587630 |
caccaaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 143 - 260
Target Start/End: Complemental strand, 15511271 - 15511150
Alignment:
| Q |
143 |
aagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcg--tacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggag |
238 |
Q |
| |
|
|||||||| |||| | ||||||||||||| |||||||||||||| ||||||||||| || |||||| ||||||| | |||||||||||||| | ||| |
|
|
| T |
15511271 |
aagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacaccaaaatggtggtaccccttcctggaccctgcgtatgtgtgag |
15511172 |
T |
 |
| Q |
239 |
ctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| |||||||||| |||||| |
|
|
| T |
15511171 |
ctttagtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 139 - 259
Target Start/End: Complemental strand, 39215083 - 39214961
Alignment:
| Q |
139 |
gttcaagtcctgaaaacaacatcttgtgtaaaaata-gggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcggg |
236 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||| |||||||||||||||||||| || || ||||||| |||||| || |||||||||||| || |
|
|
| T |
39215083 |
gttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaatggtgggtccccttcccaaaccctgcgtatgtgga |
39214984 |
T |
 |
| Q |
237 |
agctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|||||| |||||||||| ||||| |
|
|
| T |
39214983 |
agctttagtgcaccgggctgccc |
39214961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 130 - 198
Target Start/End: Complemental strand, 50760359 - 50760290
Alignment:
| Q |
130 |
aggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacacc |
198 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| |||| ||||||||||||||| |||||||| |
|
|
| T |
50760359 |
aggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgtataatacacc |
50760290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 160 - 232
Target Start/End: Original strand, 21723739 - 21723811
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatg |
232 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||| |||||| | ||| || |||||||||||||||| |
|
|
| T |
21723739 |
tcttgtataaaaatagggtaaggctgagtacaatacaccaaatggtagaaccttttcccggaccctgcgtatg |
21723811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 131 - 248
Target Start/End: Complemental strand, 17470478 - 17470361
Alignment:
| Q |
131 |
ggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
||||| ||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| ||| ||||||||| || || || |||||| |
|
|
| T |
17470478 |
ggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatagtgggacccgtt-cctga-cctgcg |
17470381 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgca |
248 |
Q |
| |
|
|||| ||||||||| ||||| |
|
|
| T |
17470380 |
tatgtgggagctttagtgca |
17470361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 33223006 - 33223093
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacacc-gaatggtgggacccc |
213 |
Q |
| |
|
|||||||||||| || ||||| || ||||| | ||||||||||||| |||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33223006 |
gaaaggtcacggatttaagtcatggaaacagcctcttgtgtaaaaacagggaaaggttgcgtacaatacaccaaaatggtgggacccc |
33223093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 181 - 247
Target Start/End: Complemental strand, 4430080 - 4430014
Alignment:
| Q |
181 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgc |
247 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||| | ||| |||| ||||||||||||||| |||| |
|
|
| T |
4430080 |
ggctgcgtacaatacaccaaatggtggaacccctttctggatcctgtgtatgcgggagctttagtgc |
4430014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 145 - 242
Target Start/End: Complemental strand, 20169207 - 20169109
Alignment:
| Q |
145 |
gtcctgaaaacaacatcttgtgtaaaaatag-ggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|||||||||||| | ||||||||||||| | |||||| ||| ||||||||| || | |||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
20169207 |
gtcctgaaaacaccctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatcggtgggactccttcccggaccctgcatatgcgggagcttt |
20169109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 200 - 253
Target Start/End: Original strand, 30555211 - 30555264
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
30555211 |
aatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccggg |
30555264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 147 - 239
Target Start/End: Complemental strand, 34149076 - 34148983
Alignment:
| Q |
147 |
cctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagc |
239 |
Q |
| |
|
|||| ||||| | ||||||||| |||||||||||||| ||||||||| | ||| ||||||| |||||||| | ||||||||| ||||| ||||| |
|
|
| T |
34149076 |
cctggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttcctggaccctgcatatgcaggagc |
34148983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 202 - 249
Target Start/End: Complemental strand, 33594191 - 33594144
Alignment:
| Q |
202 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
33594191 |
tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcac |
33594144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 49722708 - 49722593
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||| ||||| || ||||||| |||||| || ||||||||||| ||||||||||| | || |||||| ||||||| || ||| || |
|
|
| T |
49722708 |
gaaaggtcacgggtttaagtcatgtaaacaacctcttgtaaaataatagggtaagattgcgtacaatatattgattggtggaaccccttcccaaaccttg |
49722609 |
T |
 |
| Q |
227 |
cgtatgcgggagcttt |
242 |
Q |
| |
|
|||||| || |||||| |
|
|
| T |
49722608 |
cgtatgtggcagcttt |
49722593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 2436029 - 2435984
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa |
172 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || |||||||||| |
|
|
| T |
2436029 |
gaaaggtcacgggttcaagtcctggaaacaacctcctgtgtaaaaa |
2435984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 242
Target Start/End: Complemental strand, 4249520 - 4249463
Alignment:
| Q |
185 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||| ||| || ||||||||||||||| |
|
|
| T |
4249520 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagcttt |
4249463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 242
Target Start/End: Complemental strand, 4249844 - 4249787
Alignment:
| Q |
185 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||| ||| || ||||||||||||||| |
|
|
| T |
4249844 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagcttt |
4249787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 185 - 242
Target Start/End: Complemental strand, 4250168 - 4250111
Alignment:
| Q |
185 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||| ||| || ||||||||||||||| |
|
|
| T |
4250168 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagcttt |
4250111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 174 - 242
Target Start/End: Original strand, 6358191 - 6358260
Alignment:
| Q |
174 |
agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||||| ||||||||||| ||||| || |||||||||||||| || |||||||||||||| ||| |||| |
|
|
| T |
6358191 |
agggtaaagctgcgtacaaaacaccaaaatggtgggaccccttcccagaccctgcgtatgcaggatcttt |
6358260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 129 - 240
Target Start/End: Complemental strand, 27136786 - 27136673
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||| |||| |||||||| ||| |||||| ||||||||| |||| | ||||||| ||||||||||||||| |||||||||||||||| | || | || |
|
|
| T |
27136786 |
aaggacacgagttcaagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaatacaccaaaatggtgggaccccttcctagatcatg |
27136687 |
T |
 |
| Q |
227 |
cgtatgcgggagct |
240 |
Q |
| |
|
||||||||||||| |
|
|
| T |
27136686 |
tgtatgcgggagct |
27136673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 24564366 - 24564445
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaatggt |
205 |
Q |
| |
|
|||||||| | | |||||||| || ||||||| |||||||| ||||| ||||||||| |||||||||| |||| |||||| |
|
|
| T |
24564366 |
gaaaggtcgcagattcaagtcttggaaacaacctcttgtgtaaaaaacagggtaagggtgcgtacaattcaccaaatggt |
24564445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 18335424 - 18335308
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| ||| |||||||| ||||| |||||| ||||||| ||||||| | ||||||||||||| | |||| |||||||| || | |||| | |
|
|
| T |
18335424 |
gaaaggtcacaagttaaagtcctggaaacagtctcttgtttaaaaattagggtaaagttgcgtacaatacatcaaatgatgggaccctttcctagaccat |
18335325 |
T |
 |
| Q |
226 |
gcgtatgcgggagcttt |
242 |
Q |
| |
|
| |||| |||||||||| |
|
|
| T |
18335324 |
gtgtatacgggagcttt |
18335308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 208 - 252
Target Start/End: Complemental strand, 25554796 - 25554752
Alignment:
| Q |
208 |
gaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
25554796 |
gaccccttcccgaaccctgcgtatgcgggagcattagtgcaccgg |
25554752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 93; Significance: 3e-45; HSPs: 59)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 28817760 - 28817628
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
28817760 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgc |
28817661 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| |
|
|
| T |
28817660 |
gtatgcgggagctttagtgcatcgggttgccct |
28817628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 13160703 - 13160834
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
13160703 |
aaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcg |
13160802 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| |||| |||||||||||| |
|
|
| T |
13160803 |
tatgcgggagcttcagtgcgccgggttgccct |
13160834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 45071266 - 45071397
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
|||||||||||||||||| ||| ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
45071266 |
aaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcg |
45071365 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
45071366 |
tatgcgggagcttcagtgcaccgggttgccct |
45071397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 36720797 - 36720929
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
36720797 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
36720896 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| |||||| ||||||| ||||||||| |
|
|
| T |
36720897 |
gtatgcggaagctttagtgcacccggttgccct |
36720929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 129 - 256
Target Start/End: Original strand, 44530150 - 44530278
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| | ||||||||| |
|
|
| T |
44530150 |
aaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgc |
44530249 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
||||||||||||||| ||||||||||||| |
|
|
| T |
44530250 |
gtatgcgggagctttagtgcaccgggttg |
44530278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 12670384 - 12670252
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
12670384 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
12670286 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | |||||||||||| |||| |
|
|
| T |
12670285 |
catatgcgggagctctagtgcaccgggttaccct |
12670252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 130 - 260
Target Start/End: Original strand, 12625891 - 12626023
Alignment:
| Q |
130 |
aggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||| |||||||||| ||||||| ||||||||||||| | ||||||| |||| ||||||||||| |||||||||||||| | ||||||||||| |
|
|
| T |
12625891 |
aggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaatacaccaaatggtgggaccccctcccggaccctgc |
12625990 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
12625991 |
gtatgcgggagctttagtgcaccgggttgccct |
12626023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 30454231 - 30454099
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||| ||||||||||||| ||||||| |||||||||||||||| |||||||||| |
|
|
| T |
30454231 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaagg-taaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctg |
30454133 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
30454132 |
catatgcgggagctctagtgcaccgggttgccct |
30454099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 31457172 - 31457305
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||| | |||||| ||||||||| || |||||| |
|
|
| T |
31457172 |
gaaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaataggaaaaggctgcgtacaatacatcaaatggtaggaccccttcccaaaccctg |
31457271 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| | ||||||||| ||||||| |
|
|
| T |
31457272 |
cgtatgcgggagctctagtgcaccggattgccct |
31457305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 39461132 - 39460996
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| || |||||||||||||||||||||| | |||||| |||||||| ||||||| |
|
|
| T |
39461132 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggacc |
39461033 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39461032 |
ctgcgtatgcgggagctttagtgcaccgggttgccct |
39460996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 8897898 - 8897766
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||||||| |||||||| ||||||| |||||||||||| |||||||||||| ||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
8897898 |
aaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaatacaccaaatggtgggaccccttcccggaccctgc |
8897799 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| |
|
|
| T |
8897798 |
atatgcgggagctttactgcacccggttgccct |
8897766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 35261680 - 35261812
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||| | ||||||||| |
|
|
| T |
35261680 |
aaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgc |
35261779 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
35261780 |
gtatgcgggagctttagtgcaccgggttgccct |
35261812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 127 - 258
Target Start/End: Complemental strand, 18164895 - 18164764
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| ||||||||| ||||||||||||||| || | || |||| || |||||||||| |
|
|
| T |
18164895 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctg |
18164796 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |
|
|
| T |
18164795 |
cgtatgcgggagctttagtgcaccgggttgcc |
18164764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 129 - 257
Target Start/End: Complemental strand, 29521819 - 29521690
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||| | |||||| |||||| ||||||||||||||||||||||||| |||||||||| ||| | || |||||||| |
|
|
| T |
29521819 |
aaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgc |
29521720 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgc |
257 |
Q |
| |
|
||||||||||||||| |||||||||||||| |
|
|
| T |
29521719 |
gtatgcgggagctttagtgcaccgggttgc |
29521690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 134 - 260
Target Start/End: Complemental strand, 5135418 - 5135292
Alignment:
| Q |
134 |
cacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatg |
232 |
Q |
| |
|
||||||||||||||||| ||||| | ||||||||||||| |||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
5135418 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatg |
5135319 |
T |
 |
| Q |
233 |
cgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||| |||||||||| |||||| |
|
|
| T |
5135318 |
caggagcttt-gtgcaccgggctgccct |
5135292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 7136663 - 7136529
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
7136663 |
aaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
7136564 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| |||||||||||| |||| |
|
|
| T |
7136563 |
gcatatgcgggagctttagtgcaccgggttaccct |
7136529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 127 - 256
Target Start/End: Complemental strand, 20284209 - 20284075
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata---gggtaaggctgcgtacaatacaccga--atggtgggaccccttgccgga |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||| |||||| | |||||||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
20284209 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgga |
20284110 |
T |
 |
| Q |
222 |
ccctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
20284109 |
ccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 6760823 - 6760957
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||| ||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
6760823 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggcttcgtacaatacaccaataatggtgggaccccttctcggacccc |
6760922 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| ||||||||||||||||| |
|
|
| T |
6760923 |
gcatatgcgggagctttagtgcaccgggttgccct |
6760957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 127 - 256
Target Start/End: Complemental strand, 21070838 - 21070703
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata----gggtaaggctgcgtacaatacaccga--atggtgggaccccttgccgg |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||| |||||| | |||||||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
21070838 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgg |
21070739 |
T |
 |
| Q |
221 |
accctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
21070738 |
accctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 17823575 - 17823709
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| ||| |||| ||||||| |||||||| |||||||| ||||||| ||| ||||| |
|
|
| T |
17823575 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggataagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccct |
17823674 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
17823675 |
gcatatgcaggagctttagtgcaccgggttgccct |
17823709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 127 - 252
Target Start/End: Original strand, 389642 - 389770
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt---aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||| ||||| ||||||||| ||||||||||||||| |||| ||||| ||||| || |||| |
|
|
| T |
389642 |
gaaaggtcacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgacc |
389741 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |
|
|
| T |
389742 |
ctgcgtatgcgagagctttagtgcaccgg |
389770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 132 - 253
Target Start/End: Complemental strand, 8484069 - 8483947
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgta |
230 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||||||||| |||| |||||||||||||||||||| | |||||||||||| | || ||||||||||| |
|
|
| T |
8484069 |
gtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgta |
8483970 |
T |
 |
| Q |
231 |
tgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|||||||||||| | |||||||| |
|
|
| T |
8483969 |
tgcgggagctttagggcaccggg |
8483947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 26954133 - 26954268
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| | |||||||||||||||||||||||| | ||||||||||||||| || |||| |
|
|
| T |
26954133 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccagacct |
26954232 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| |||||| |||||||||| |
|
|
| T |
26954233 |
cgcatatgcgggagctttagtgcactgggttgccct |
26954268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 2626518 - 2626655
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata----gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggac |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| | ||||||| |||||||||||||||| |||| ||||||||||| || ||| |
|
|
| T |
2626518 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagggtaagactgcgtacaatacaccaaatgatgggaccccttcccagac |
2626617 |
T |
 |
| Q |
223 |
cctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| ||||||||||||| ||||||| | ||||||| |
|
|
| T |
2626618 |
cctgcatatgcgggagcttcagtgcaccagattgccct |
2626655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 168 - 260
Target Start/End: Original strand, 29877135 - 29877227
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| || ||||||| || |||||| |
|
|
| T |
29877135 |
aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccaggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 132 - 243
Target Start/End: Complemental strand, 24365191 - 24365078
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat--agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgt |
229 |
Q |
| |
|
|||||||||||||| ||| ||||| | ||||||||||||| |||||||||||||| |||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
24365191 |
gtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaatggtgggaccccttcccggaccctgcgt |
24365092 |
T |
 |
| Q |
230 |
atgcgggagctttg |
243 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
24365091 |
atgtgggagctttg |
24365078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 249
Target Start/End: Complemental strand, 44781642 - 44781517
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||| |||||||||||||||||| ||||||| |||||||||||| | |||||||||||| |||||||||||| |||| ||||||||| | || |||| |
|
|
| T |
44781642 |
gaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagacc |
44781543 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
||||||||||||||||||| |||||| |
|
|
| T |
44781542 |
ctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 25250523 - 25250657
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||| |||||||||||| ||||| | | ||||||||||| ||||||| |||||||||||||||||| | ||||||||||||||| ||| |||| |
|
|
| T |
25250523 |
aaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggtatggctgcgtacaatacaccaataatggtgggaccccttcccgaacccc |
25250622 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
25250623 |
gcatatgcgggagatttagtgcaccgggttgccct |
25250657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 137 - 257
Target Start/End: Original strand, 5689640 - 5689761
Alignment:
| Q |
137 |
gggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgg |
235 |
Q |
| |
|
||||||||||| || ||| | | ||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||| ||| ||| |||||||| || |
|
|
| T |
5689640 |
gggttcaagtcttgtaaatagcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgg |
5689739 |
T |
 |
| Q |
236 |
gagctttggtgcaccgggttgc |
257 |
Q |
| |
|
||||||| ||||||||| |||| |
|
|
| T |
5689740 |
gagctttagtgcaccggtttgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 239
Target Start/End: Complemental strand, 20869632 - 20869523
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||| |||| |||||||||||| |||||||||||| | |||| |||||||| |||||||||| |
|
|
| T |
20869632 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaacagggtaaggctgtgtacaatacacc--aaggtgagaccccttcccggaccctg |
20869536 |
T |
 |
| Q |
227 |
cgtatgcgggagc |
239 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
20869535 |
catatgcgggagc |
20869523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 168 - 260
Target Start/End: Original strand, 10857870 - 10857962
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||||||||||||| |||||||||| | |||||||||| ||| | ||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10857870 |
aaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgccct |
10857962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 160 - 260
Target Start/End: Original strand, 20869955 - 20870058
Alignment:
| Q |
160 |
tcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| | |||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
20869955 |
tcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttg |
20870054 |
T |
 |
| Q |
257 |
ccct |
260 |
Q |
| |
|
|||| |
|
|
| T |
20870055 |
ccct |
20870058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 22598156 - 22598279
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||| ||||| ||||||||||| |||||||||||| | ||||| ||||| || ||||||| | |
|
|
| T |
22598156 |
gaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaattggtgagaccctttcccggacctt |
22598255 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
|||||||||||| |||| ||||||| |
|
|
| T |
22598256 |
gcgtatgcggga-ctttagtgcacc |
22598279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 127 - 225
Target Start/End: Original strand, 35105922 - 35106022
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||| | || |||||||||||||||||||||| ||||||||||||| ||| | |||||| |
|
|
| T |
35105922 |
gaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatggtgggacctcttcctggaccc |
35106021 |
T |
 |
| Q |
225 |
t |
225 |
Q |
| |
|
| |
|
|
| T |
35106022 |
t |
35106022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 28407417 - 28407536
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| |||||||||| ||| |||||||||||||||| ||||||||| || |
|
|
| T |
28407417 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggc------------accaaatggtgggaccccttcccggaccctacg |
28407504 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |
|
|
| T |
28407505 |
tatgcgggagctttactgcaccgggttgccct |
28407536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 188 - 260
Target Start/End: Original strand, 26102578 - 26102650
Alignment:
| Q |
188 |
tacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
26102578 |
tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccct |
26102650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 169 - 260
Target Start/End: Original strand, 19729382 - 19729473
Alignment:
| Q |
169 |
aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| |||||||||||| |||||||||||| |||||||||||||||| ||||||||||| ||| |||||||| | |||||| || ||||||| |
|
|
| T |
19729382 |
aaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgccct |
19729473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 171 - 255
Target Start/End: Original strand, 26457773 - 26457855
Alignment:
| Q |
171 |
aatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggtt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| || |||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
26457773 |
aatagggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtt |
26457855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 129 - 259
Target Start/End: Complemental strand, 44742653 - 44742521
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||| | |||||||| ||| |||||| || |||||||||| ||||||||||||||||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
44742653 |
aaggtcatgagttcaagttctggaaacaatctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggacccta |
44742554 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|| |||||||||| || |||||||||| ||||| |
|
|
| T |
44742553 |
cggatgcgggagcattagtgcaccggggtgccc |
44742521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 168 - 256
Target Start/End: Original strand, 16225060 - 16225150
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
||||| |||||||| |||||||||||||||| | ||||||||| ||||| |||||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
16225060 |
aaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
16225150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 248
Target Start/End: Complemental strand, 42083835 - 42083712
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | | ||||||| ||||| ||| ||||||||||||| || ||| |||||||||||||||| ||| |||| |
|
|
| T |
42083835 |
gaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaaaatggtgggaccccttcccgaaccc |
42083736 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgca |
248 |
Q |
| |
|
|| ||| | ||||||||| ||||| |
|
|
| T |
42083735 |
tgtgtacgtgggagctttagtgca |
42083712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 23000352 - 23000230
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||| |||||||| ||||| | ||||||||||||| | ||||||| | | ||||||||||| |||||||||||||||| |||| |
|
|
| T |
23000352 |
gaaaggtcacgggt--aagtcctggaaacagcctcttgtgtaaaaacacggtaaggttccatacaatacaccaaatggtgggaccccttcccgg------ |
23000261 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |
|
|
| T |
23000260 |
---atgcgggagctttagtgcaccgggttgccct |
23000230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 256
Target Start/End: Original strand, 27507985 - 27508039
Alignment:
| Q |
202 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttg |
27508039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 139 - 259
Target Start/End: Complemental strand, 17251001 - 17250879
Alignment:
| Q |
139 |
gttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgg |
235 |
Q |
| |
|
|||||||||||| || || | ||||||||||||| ||| |||||| |||||||||||||| | |||||||||||| || ||| |||||||||||| | |
|
|
| T |
17251001 |
gttcaagtcctggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaag |
17250902 |
T |
 |
| Q |
236 |
gagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
||||||| ||||| |||||||||| |
|
|
| T |
17250901 |
gagctttagtgca-cgggttgccc |
17250879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 260
Target Start/End: Complemental strand, 35107373 - 35107313
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| |||||| ||| |||||||| |||||| ||||||||||||||||| |
|
|
| T |
35107373 |
aatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccct |
35107313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 284 - 339
Target Start/End: Original strand, 13112566 - 13112621
Alignment:
| Q |
284 |
gatgatattgattctacatctgttggtatagaagcagaggcgtataggttttcaat |
339 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
13112566 |
gatgatattgattctacgtctgttggtatagaagcataggcgaataggttctcaat |
13112621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 217 - 260
Target Start/End: Complemental strand, 27468137 - 27468094
Alignment:
| Q |
217 |
ccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27468137 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
27468094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 241
Target Start/End: Complemental strand, 11001086 - 11000970
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatag--ggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||| | |||||||||| | | |||||||| |||||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
11001086 |
gaaaggtcgcgggttcaaattctgaaaacaacctactgtgtaaaaaaacaagataaggctgtgtacaatacaccaaatggtgggacccctacccgaaccc |
11000987 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctt |
241 |
Q |
| |
|
|| ||||| ||||||| |
|
|
| T |
11000986 |
tgtttatgcaggagctt |
11000970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 256
Target Start/End: Original strand, 16013529 - 16013585
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
||||||| |||||||| || |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
16013529 |
aatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttg |
16013585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 201 - 260
Target Start/End: Complemental strand, 36486627 - 36486568
Alignment:
| Q |
201 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||||| |||||||| |||| |||||||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccct |
36486568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 24245450 - 24245564
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaa---tggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| |||| | |||| ||||| | ||||||| || |||||||| |||| || | |||||||||||| | ||||| |
|
|
| T |
24245450 |
gaaaggtcacgggttcaagtcctggaaacgtc-tcttatgtaaca---gggtaagactacgtacaatgcaccaaaaaattgtgggaccccttcctggacc |
24245545 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24245546 |
ctgcgtatgcgggagcttt |
24245564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 206 - 260
Target Start/End: Original strand, 40444845 - 40444899
Alignment:
| Q |
206 |
gggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||| | |||||| |
|
|
| T |
40444845 |
gggaccccttgccggaccctgcgtatgttggagctttagtgcaccgagctgccct |
40444899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 241
Target Start/End: Complemental strand, 14018105 - 14017989
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||| ||||||||||| || ||||| ||||||||| |||| ||||| || ||||||||||||||| || |||||||||| ||| | |||||| |
|
|
| T |
14018105 |
gaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaaattggtgggaccacttcctggaccc |
14018006 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctt |
241 |
Q |
| |
|
||| |||||| ||||| |
|
|
| T |
14018005 |
tgcagatgcggtagctt |
14017989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 160 - 212
Target Start/End: Complemental strand, 23286426 - 23286375
Alignment:
| Q |
160 |
tcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccc |
212 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
23286426 |
tcttgtgtaaaac-agggtaaagctgcgtacaatacaccaaatggtgggaccc |
23286375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 207 - 258
Target Start/End: Original strand, 18595918 - 18595969
Alignment:
| Q |
207 |
ggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||| ||||| ||||||||| |
|
|
| T |
18595918 |
ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcc |
18595969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 218 - 260
Target Start/End: Complemental strand, 30962815 - 30962773
Alignment:
| Q |
218 |
cggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
30962815 |
cggaccctgcgtatgcgggagatttagtgaaccgggttgccct |
30962773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 188
Target Start/End: Complemental strand, 30962909 - 30962847
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgt |
188 |
Q |
| |
|
||||||||||| ||||||||||| ||||| | ||||||||| |||||||||| ||||||||| |
|
|
| T |
30962909 |
gaaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaaaatagggttaggctgcgt |
30962847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 215
Target Start/End: Original strand, 43942365 - 43942414
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacacc--gaatggtgggacccctt |
215 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43942365 |
aaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggacccctt |
43942414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 198
Target Start/End: Original strand, 36918123 - 36918195
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacacc |
198 |
Q |
| |
|
|||||||||| |||||||| ||| |||||| |||| |||||||| |||||||||||| |||||||||||| |
|
|
| T |
36918123 |
gaaaggtcacatgttcaagttctggaaacaatttcttatgtaaaaaacagggtaaggctgtgtacaatacacc |
36918195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 93; Significance: 3e-45; HSPs: 65)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 24448891 - 24449023
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||| | | |||||||||| ||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
24448891 |
aaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
24448990 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| |
|
|
| T |
24448991 |
gtatgcaggagctttagtgcaccgggttgccct |
24449023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 41014320 - 41014451
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| | |||||| || |
|
|
| T |
41014320 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgca |
41014419 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
41014420 |
tatgcgggagctttagtgcaccgggttgccct |
41014451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 32703423 - 32703555
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
32703423 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
32703521 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
32703522 |
catatgcgggagctctagtgcaccgggttgccct |
32703555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 38879580 - 38879716
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||| |||||| ||||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
38879580 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacc |
38879679 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38879680 |
ctgcgtatgcgggagctttagtgcaccgggttgccct |
38879716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 8170118 - 8169986
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | | |||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
8170118 |
gaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
8170020 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||| || ||||||||||||||||| |
|
|
| T |
8170019 |
catatgcgggagtttcagtgcaccgggttgccct |
8169986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 35710312 - 35710444
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| |||||||||||||||| ||||||||| |||||||||||||||| ||||| | || |
|
|
| T |
35710312 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa-tagggtaaggctgcgttcaatacaccaaatggtgggaccccttcccggaacatg |
35710410 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
35710411 |
catatgcgggagctctagtgcaccgggttgccct |
35710444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 138 - 249
Target Start/End: Complemental strand, 19143067 - 19142956
Alignment:
| Q |
138 |
ggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcggga |
237 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||| |||||||||||||||||| |||||| |||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
19143067 |
ggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggctgcgtacagtacaccaaatggtgggaccccttcccggaccatgcgtatgcggga |
19142968 |
T |
 |
| Q |
238 |
gctttggtgcac |
249 |
Q |
| |
|
| ||| |||||| |
|
|
| T |
19142967 |
gatttagtgcac |
19142956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 43334201 - 43334337
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt--aaaaatagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggac |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | || ||||| ||||| ||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
43334201 |
gaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggac |
43334300 |
T |
 |
| Q |
223 |
cctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
43334301 |
cctgcg-atgcgggagctttagtgcaccgggttgccct |
43334337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 131 - 253
Target Start/End: Original strand, 43574609 - 43574732
Alignment:
| Q |
131 |
ggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgt |
229 |
Q |
| |
|
||||||| |||||||||||| |||||| ||||||||| |||| ||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
43574609 |
ggtcacgtgttcaagtcctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgt |
43574708 |
T |
 |
| Q |
230 |
atgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
||||||||||||| | |||||||| |
|
|
| T |
43574709 |
atgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 4619240 - 4619106
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||||| ||| | | ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
4619240 |
aaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacccc |
4619141 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
4619140 |
gcatatgcgagagctttagtgcaccgggttgccct |
4619106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 129 - 242
Target Start/End: Original strand, 22600455 - 22600569
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||| |||||||||||||||| |||||| || |||||||||| | |||||||||||| |||||||||||| |||||||||| ||||| ||||| ||||| |
|
|
| T |
22600455 |
aaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggtaaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgc |
22600554 |
T |
 |
| Q |
228 |
gtatgcgggagcttt |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
22600555 |
gtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 152 - 248
Target Start/End: Original strand, 2838803 - 2838899
Alignment:
| Q |
152 |
aaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
248 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||| | |||||| |
|
|
| T |
2838803 |
aaacagcatcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagcatcggtgca |
2838899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 150 - 250
Target Start/End: Complemental strand, 7097872 - 7097772
Alignment:
| Q |
150 |
gaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||| ||||||||||||||| ||||||| |||||||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
7097872 |
gaaaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
7097773 |
T |
 |
| Q |
250 |
c |
250 |
Q |
| |
|
| |
|
|
| T |
7097772 |
c |
7097772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 143 - 259
Target Start/End: Original strand, 7368413 - 7368528
Alignment:
| Q |
143 |
aagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| | |||||||||||||| ||||||||||| |||| ||||||| | |
|
|
| T |
7368413 |
aagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctct |
7368511 |
T |
 |
| Q |
243 |
ggtgcaccgggttgccc |
259 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7368512 |
agtgcaccgggttgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 137 - 260
Target Start/End: Complemental strand, 13801895 - 13801769
Alignment:
| Q |
137 |
gggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgc |
233 |
Q |
| |
|
|||||||||||||| || || | ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| |||||||| || ||||| |
|
|
| T |
13801895 |
gggttcaagtcctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
13801796 |
T |
 |
| Q |
234 |
gggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||||| ||||||||||||||||| |
|
|
| T |
13801795 |
gagagctttagtgcaccgggttgccct |
13801769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 127 - 242
Target Start/End: Original strand, 27328751 - 27328869
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| ||| ||| |
|
|
| T |
27328751 |
gaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccgaacc |
27328850 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27328851 |
ctgcgtatgcgggagcttt |
27328869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 174 - 260
Target Start/End: Complemental strand, 34154902 - 34154816
Alignment:
| Q |
174 |
agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||| |||| | ||||||||||||||||| |
|
|
| T |
34154902 |
agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgccct |
34154816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 127 - 252
Target Start/End: Original strand, 1850639 - 1850764
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||| ||||||||||||| || ||||| ||||||||||||| | |||||||||||| ||| | |||||||| |
|
|
| T |
1850639 |
gaaaggtcacgggttcaagtcccggaaataacctcttgtgtaaaaacagaataagggtgcgtacaatacatcaaatggtgggaccacttcctggaccctg |
1850738 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
|| |||||| |||||| ||||||||| |
|
|
| T |
1850739 |
cggatgcggaagctttagtgcaccgg |
1850764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 160 - 260
Target Start/End: Complemental strand, 16880750 - 16880649
Alignment:
| Q |
160 |
tcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||| |||| ||| ||||||| |||||||||||||||||| |||||||||||| || |
|
|
| T |
16880750 |
tcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggtttcc |
16880651 |
T |
 |
| Q |
259 |
ct |
260 |
Q |
| |
|
|| |
|
|
| T |
16880650 |
ct |
16880649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 187 - 260
Target Start/End: Original strand, 16957374 - 16957447
Alignment:
| Q |
187 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16957374 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
16957447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 128 - 253
Target Start/End: Complemental strand, 209062 - 208936
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||||||||||||| ||||||||||||| | ||||||||| |||||||||||||||| | |||||||| |
|
|
| T |
209062 |
aaaggtcacaagttcaagtcctggcaacaacctcttgtgtaaaaacagggtaaggctgcattcaatacaccaaaatggtgggaccccttcctggaccctg |
208963 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|||||| ||||||| |||||||||| |
|
|
| T |
208962 |
ggtatgcaagagctttagtgcaccggg |
208936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 12006466 - 12006330
Alignment:
| Q |
127 |
gaaaggtcacggg-ttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggac |
222 |
Q |
| |
|
||||||||||||| |||||||| || ||||||| |||| |||||||| |||||||||||| | ||||||||||| | ||||||||||||||| || ||| |
|
|
| T |
12006466 |
gaaaggtcacggggttcaagtc-tggaaacaacctcttatgtaaaaaatagggtaaggctccatacaatacaccaataatggtgggaccccttcccagac |
12006368 |
T |
 |
| Q |
223 |
cctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
12006367 |
cctgcctatgcgggagctttagtgcaccgtgttgccct |
12006330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 1405188 - 1405320
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||| | |||||| ||| ||||| ||||||||||||||| ||||||||||||| || | | ||||||| |
|
|
| T |
1405188 |
aaggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtgggaccctttcctgaaccctgc |
1405287 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||| | || |||||| ||||||| |
|
|
| T |
1405288 |
atatgcgggagctctagtacaccggattgccct |
1405320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 1565430 - 1565564
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaataggg--taaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| ||||| ||||||| | |||||||||||||||| |||| ||||| |||||||||| |||||||| |
|
|
| T |
1565430 |
gaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatattaaggctgcgtacaatgcaccaaatggcgggaccccttcccggaccc |
1565529 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||| |||| |||||| || ||||||||||||||||| |
|
|
| T |
1565530 |
tgcatatgtgggagc-ttagtgcaccgggttgccct |
1565564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 42924970 - 42924840
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccgg--a |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||| |||| ||| | ||||| || | | |
|
|
| T |
42924970 |
gaaaggtcacgagttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttcccagaca |
42924871 |
T |
 |
| Q |
222 |
ccctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| |
|
|
| T |
42924870 |
ccctgcgtatgcggaagctttagtgcaccgg |
42924840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 143 - 260
Target Start/End: Complemental strand, 5873441 - 5873324
Alignment:
| Q |
143 |
aagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||| || ||||| | ||||||||||||||||||||||||| ||||| |||||| | ||||||||| ||| |||||| ||||||||||||||||||| |
|
|
| T |
5873441 |
aagtcgtggaaacagcctcttgtgtaaaaatagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagcttt |
5873342 |
T |
 |
| Q |
243 |
ggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||| |||||| |
|
|
| T |
5873341 |
agtgcatcgggatgccct |
5873324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 127 - 258
Target Start/End: Original strand, 30006324 - 30006456
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaa-aatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| | ||||||||| ||||||||| |||| | |||| || |||||||||||| ||||| ||||| |||||||||||||||| |||| ||| |
|
|
| T |
30006324 |
gaaaggtcatagattcaagtccggaaaacaacctcttatataaacaacagggtaaggctgtgtacattacactaaatggtgggaccccttcccggggcct |
30006423 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
30006424 |
atgtatgcgggagctttagtgcaccgggttgcc |
30006456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 28516570 - 28516435
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaataca-ccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||||||||||||| || ||||| | ||||||||| |||| ||| || |||||||||||||||| | ||||||||||||| || || ||||| |
|
|
| T |
28516570 |
gaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaatggtgggacccattcccagaccc |
28516471 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| |||| |||||||| ||| ||| ||||||||| |
|
|
| T |
28516470 |
tgcgcatgcaggagctttagtggaccaggttgccct |
28516435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 160 - 260
Target Start/End: Original strand, 29334427 - 29334529
Alignment:
| Q |
160 |
tcttgtgtaaaaat-agggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgc |
257 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||| |||||||||||||| || |||||||||||||||| |||| |||| ||||||||| ||| |
|
|
| T |
29334427 |
tcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcaccgggctgc |
29334526 |
T |
 |
| Q |
258 |
cct |
260 |
Q |
| |
|
||| |
|
|
| T |
29334527 |
cct |
29334529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 184 - 260
Target Start/End: Complemental strand, 12575739 - 12575662
Alignment:
| Q |
184 |
tgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| || |||||||||||||| | ||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
12575739 |
tgcgtacaatacaccaaaatggtgggaccccttcctggaccctgcgtatgcaggagctttggtgcaccgggctgccct |
12575662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 147 - 260
Target Start/End: Original strand, 20135623 - 20135739
Alignment:
| Q |
147 |
cctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttg |
243 |
Q |
| |
|
|||| ||||| | ||||||||||||| | ||||||||||||||||||||||| | ||||||||||||||| |||||||| || ||||| ||||||| |
|
|
| T |
20135623 |
cctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttca |
20135722 |
T |
 |
| Q |
244 |
gtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
20135723 |
gtgcaccgggttgccct |
20135739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 168 - 260
Target Start/End: Original strand, 3771380 - 3771472
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||||||||||| | |||||||||| | |||||||||||||| |||||| ||| ||||| ||||||||| |||||||||| |||||| |
|
|
| T |
3771380 |
aaaaacagggtaaggctgtgaacaatacaccaattggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgccct |
3771472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 25622533 - 25622593
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
25622533 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccct |
25622593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 127 - 253
Target Start/End: Original strand, 39301122 - 39301249
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||||||||||||| || |||||| ||||||||| |||| ||||||||| |||||| ||| |||| || ||||||||||||| |||||||| |
|
|
| T |
39301122 |
gaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaaaaaggtgggaccccttcccggaccc |
39301221 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
| |||||| ||||| ||| |||||||||| |
|
|
| T |
39301222 |
tccgtatgtgggag-tttagtgcaccggg |
39301249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 234
Target Start/End: Original strand, 41425952 - 41426055
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgta |
230 |
Q |
| |
|
||||||||||||||| ||| ||||||| | ||||||||||| ||||||||||||| ||||||||||| | |||||||||||||| || ||| ||||| | |
|
|
| T |
41425952 |
gtcacgggttcaagttctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccagactctgcgga |
41426051 |
T |
 |
| Q |
231 |
tgcg |
234 |
Q |
| |
|
|||| |
|
|
| T |
41426052 |
tgcg |
41426055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 142 - 253
Target Start/End: Complemental strand, 24903817 - 24903705
Alignment:
| Q |
142 |
caagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagct |
240 |
Q |
| |
|
||||||||||||||| | | ||||||||||| ||||||||| || ||||||| |||| | ||||| |||||||| |||||| |||| || |||||| || |
|
|
| T |
24903817 |
caagtcctgaaaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaattggtgagaccccttcccggacactgcatacgcgggaact |
24903718 |
T |
 |
| Q |
241 |
ttggtgcaccggg |
253 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24903717 |
ttggtgcaccggg |
24903705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 200 - 259
Target Start/End: Complemental strand, 21784394 - 21784335
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
21784394 |
aatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 214
Target Start/End: Complemental strand, 22908000 - 22907913
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggacccct |
214 |
Q |
| |
|
||||||||| |||||||||||| ||||| | ||||||||||||| || |||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
22908000 |
gaaaggtcaagggttcaagtccaagaaacagcctcttgtgtaaaaacagagtaaggttgcatacaatacaccaaatggtgggacccct |
22907913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 253
Target Start/End: Original strand, 13774921 - 13774991
Alignment:
| Q |
183 |
ctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
||||| |||||||||| ||||| ||| ||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13774921 |
ctgcgcacaatacaccaaatggcaggatccctttccggaccctgcgtatgcgggagctttagtgcaccggg |
13774991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 248
Target Start/End: Original strand, 18426038 - 18426160
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||| ||||| |||| ||||| ||||||||| ||||||||||||| ||| | |||| || |||||||||| ||||||||| |||||||| || || || |
|
|
| T |
18426038 |
gaaatgtcacaggtttaagtcttgaaaacaatctcttgtgtaaaaaatagagaaaggttgtgtacaatacatcgaatggtgagaccccttttcgaactct |
18426137 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgca |
248 |
Q |
| |
|
||||||||| ||||||| ||||| |
|
|
| T |
18426138 |
gcgtatgcgagagctttagtgca |
18426160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 203 - 260
Target Start/End: Complemental strand, 16028683 - 16028626
Alignment:
| Q |
203 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
16028626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 139 - 243
Target Start/End: Complemental strand, 24323829 - 24323724
Alignment:
| Q |
139 |
gttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcggga |
237 |
Q |
| |
|
|||||||| ||| ||||||| |||||||||||| | |||||||| |||||| ||||| || ||| |||||||||||| || ||||||| ||||||||| |
|
|
| T |
24323829 |
gttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcggga |
24323730 |
T |
 |
| Q |
238 |
gctttg |
243 |
Q |
| |
|
|||||| |
|
|
| T |
24323729 |
gctttg |
24323724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 139 - 243
Target Start/End: Complemental strand, 24360453 - 24360348
Alignment:
| Q |
139 |
gttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcggga |
237 |
Q |
| |
|
|||||||| ||| ||||||| |||||||||||| | |||||||| |||||| ||||| || ||| |||||||||||| || ||||||| ||||||||| |
|
|
| T |
24360453 |
gttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatagtgggaccccttcccagaccctgtatatgcggga |
24360354 |
T |
 |
| Q |
238 |
gctttg |
243 |
Q |
| |
|
|||||| |
|
|
| T |
24360353 |
gctttg |
24360348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 127 - 192
Target Start/End: Complemental strand, 37024690 - 37024626
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaa |
192 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||| |||| ||||||||||||||||||| |
|
|
| T |
37024690 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaacagggtaaggctgcgtacaa |
37024626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 258
Target Start/End: Original strand, 39801591 - 39801647
Alignment:
| Q |
202 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||||| || |||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc |
39801647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 129 - 187
Target Start/End: Original strand, 23974781 - 23974840
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcg |
187 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| ||||| |||||||||||||| |
|
|
| T |
23974781 |
aaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaagagggtaaggctgcg |
23974840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 200 - 242
Target Start/End: Complemental strand, 10306536 - 10306494
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10306536 |
aatggtgggaccccttcccggaccctgcgtatgcgggagcttt |
10306494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 178 - 250
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
| Q |
178 |
taaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| ||||| |||||||||| ||||||| ||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc |
12477132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 203 - 260
Target Start/End: Complemental strand, 30877623 - 30877566
Alignment:
| Q |
203 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||||||| | ||||||||||||||||| |
|
|
| T |
30877623 |
ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccct |
30877566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 211 - 260
Target Start/End: Original strand, 32354211 - 32354260
Alignment:
| Q |
211 |
cccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccct |
32354260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 205 - 260
Target Start/End: Complemental strand, 29184118 - 29184063
Alignment:
| Q |
205 |
tgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| ||||| | |||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29184118 |
tgggactccttgtcagaccatgcgtatgcgggagctttagtgcaccgggttgccct |
29184063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 154 - 260
Target Start/End: Complemental strand, 37226070 - 37225963
Alignment:
| Q |
154 |
acaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
|||||||||||| ||||||| ||||||| || |||||||||| | || |||||||||||||| ||| ||| ||||||||| ||| ||| |||||| || |
|
|
| T |
37226070 |
acaacatcttgtataaaaattgggtaagaatgtgtacaatacaacaaaatggtgggaccccttcccgaaccatgcgtatgccagaggtttagtgcactgg |
37225971 |
T |
 |
| Q |
253 |
gttgccct |
260 |
Q |
| |
|
||||||| |
|
|
| T |
37225970 |
attgccct |
37225963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 22861802 - 22861671
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||| |||||||||| || || |||||||||||| || |||| |||| |||||||| | |||||||||||||||| || |||||| |
|
|
| T |
22861802 |
gaaaggtcacggattcaagtcctagaagcagtctcttgtgtaaaacaag--taagactgctcacaatacatcaaatggtgggaccccttctcgaaccctg |
22861705 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | |||||||| ||||||| |
|
|
| T |
22861704 |
catatgcgggagctctagtgcaccgaattgccct |
22861671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 168 - 250
Target Start/End: Complemental strand, 31694202 - 31694120
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
||||||||| ||| ||||| ||||||||||| | || |||||| |||| || |||| |||||||||||||| ||| ||||||| |
|
|
| T |
31694202 |
aaaaataggctaaagctgcatacaatacacctattgatgggactccttcccagaccttgcgtatgcgggagatttagtgcacc |
31694120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 177 - 260
Target Start/End: Complemental strand, 11657785 - 11657701
Alignment:
| Q |
177 |
gtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||| ||||||||||| || |||||||||||||| ||| ||||||| | |||||| |||| || ||||||| |||||| |
|
|
| T |
11657785 |
gtaaggctgcatacaatacaccaaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgccct |
11657701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 200 - 240
Target Start/End: Complemental strand, 21542529 - 21542489
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagct |
240 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
21542529 |
aatggtgggaccccttcccggactctgcgtatgcgggagct |
21542489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 127 - 185
Target Start/End: Original strand, 22025542 - 22025601
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctg |
185 |
Q |
| |
|
||||||||| |||||||||||||| ||||| | |||||||| ||||| |||||||||||| |
|
|
| T |
22025542 |
gaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctg |
22025601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 249
Target Start/End: Complemental strand, 3176839 - 3176770
Alignment:
| Q |
177 |
gtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||||| |||||| ||| |||||| |||||||| |||||| |
|
|
| T |
3176839 |
gtaaggttgcgtacaatacaccaactggtgggacccc---ccggactctgtgtatgccggagctttagtgcac |
3176770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 206 - 260
Target Start/End: Complemental strand, 10943900 - 10943847
Alignment:
| Q |
206 |
gggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
10943900 |
gggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgccct |
10943847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 240
Target Start/End: Complemental strand, 34074698 - 34074584
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| ||||||||||| ||||| | ||||||||||||| | |||||| ||||| ||||||||| ||||| || |||||| || ||||| |
|
|
| T |
34074698 |
gaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatggcagggccccttcccaaaccct |
34074599 |
T |
 |
| Q |
226 |
gcgtatgcgggagct |
240 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
34074598 |
gcgtatgggggagct |
34074584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 257
Target Start/End: Original strand, 18684366 - 18684403
Alignment:
| Q |
220 |
gaccctgcgtatgcgggagctttggtgcaccgggttgc |
257 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18684366 |
gaccctgcgtatgcgggagctttagtgcatcgggttgc |
18684403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 128 - 156
Target Start/End: Complemental strand, 9794494 - 9794466
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaaca |
156 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9794494 |
aaaggtcacgggttcaagtcctgaaaaca |
9794466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 208 - 260
Target Start/End: Original strand, 19093894 - 19093946
Alignment:
| Q |
208 |
gaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| |||||||||| |||||| |
|
|
| T |
19093894 |
gacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgccct |
19093946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 198
Target Start/End: Original strand, 22187284 - 22187356
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc |
198 |
Q |
| |
|
|||||||||| |||| |||||||| ||||| | |||||||| ||||| | | |||| |||||||||||||||| |
|
|
| T |
22187284 |
gaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgataagactgcgtacaatacacc |
22187356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 187 - 258
Target Start/End: Complemental strand, 39079827 - 39079755
Alignment:
| Q |
187 |
gtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||| || |||||||||||||| ||||||| || |||| |||||| ||| |||||| ||| |||| |
|
|
| T |
39079827 |
gtacaatacaccaaaatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc |
39079755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 93; Significance: 3e-45; HSPs: 74)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 8455450 - 8455318
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||||| | |||||||||||| | ||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
8455450 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgc |
8455351 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||| |
|
|
| T |
8455350 |
gtatgccggagctttagtgcaccgggttgccct |
8455318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 10546161 - 10546296
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||| |||||| | |||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
10546161 |
gaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
10546260 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10546261 |
tgcgtatgcgggagctttagtgcaccgggttgccct |
10546296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 125 - 260
Target Start/End: Original strand, 9671178 - 9671312
Alignment:
| Q |
125 |
tggaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||| ||||||||||||| ||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
9671178 |
tggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccc |
9671276 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9671277 |
tgcgtatgcgggagctttagtgcaccgggttgccct |
9671312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 14444730 - 14444861
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||| |||||||||||| |||| ||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
14444730 |
aaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgtgtacgatacaccaaatggtgggaccccttcccggaccctgcg |
14444829 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| |
|
|
| T |
14444830 |
tatgcgggagctttagtgcaccaggttgccct |
14444861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 10543697 - 10543833
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| |||| | ||||||||||||| ||||||||||||||||||||||||| || |||||||||||||| ||||||| |
|
|
| T |
10543697 |
gaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggacc |
10543796 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10543797 |
ctgcgtatgcgggagctttagtgcaccgggttgccct |
10543833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 14530317 - 14530453
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||| |||||| ||||||||||| ||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
14530317 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaaggctacgtacaatacaccaataatggtgggaccccttcccggacc |
14530416 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14530417 |
ctgcgtatgcgggagctttagtgcaccgggttgccct |
14530453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 21779395 - 21779263
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| | ||| | |||||||||||| ||||||||| ||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
21779395 |
gaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
21779297 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
21779296 |
catatgcgggagctctagtgcaccgggttgccct |
21779263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 17668003 - 17668135
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| |||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||| || ||||||| |
|
|
| T |
17668003 |
aaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttctcgaaccctgc |
17668102 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||| |
|
|
| T |
17668103 |
gtatatgggagctttagtgcaccgggttgccct |
17668135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 25249871 - 25249740
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||| ||| ||||||||||||||||||||||||| |||||||||| ||||| ||| |||||||| |
|
|
| T |
25249871 |
aaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaacagggtaaggctgcgtacaatacaccaaatggtgggatcccttcccgaaccctgcg |
25249772 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| |
|
|
| T |
25249771 |
tatgcgtgagctttagtgcaccgggttgccct |
25249740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 25079852 - 25079719
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatag--ggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||||||||||||| | ||||||| |||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25079852 |
aaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaaggtaaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctg |
25079753 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| |
|
|
| T |
25079752 |
cgtatgcaagagctttagtgcaccgggttgccct |
25079719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 12024054 - 12023929
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
12024054 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccctcccggaccctg |
12023955 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
||||| || |||||| |||||||| |
|
|
| T |
12023954 |
cgtatttggaagctttaatgcaccgg |
12023929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 23397765 - 23397897
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||| |||||||||||||| ||||| | |||||||||||| |||||||||||| ||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
23397765 |
gaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaa-tagggtaaggctacgtacaatacaccaaatggtgggaccccttctcggacccta |
23397863 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
23397864 |
catatgcgggagctctagtgcaccgggttgccct |
23397897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 17623565 - 17623697
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||| ||| | ||||| |
|
|
| T |
17623565 |
aaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaatcctgc |
17623664 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| || |||||| |||||| |||||||||| |
|
|
| T |
17623665 |
gtatgtggaagctttagtgcactgggttgccct |
17623697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 17896258 - 17896393
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa--atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| ||| |||||||||||||||| ||||||| |
|
|
| T |
17896258 |
gaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaaggctgcgtacaatataccaaatggtgggaccccttctcggaccc |
17896357 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| ||||||||| ||||| || |||||||| |
|
|
| T |
17896358 |
tgcgtatgtgggagctttagtgcatcgagttgccct |
17896393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 144 - 260
Target Start/End: Original strand, 36871509 - 36871624
Alignment:
| Q |
144 |
agtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
243 |
Q |
| |
|
||||||| ||||| | |||||||| |||| ||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
36871509 |
agtcctggaaacagcctcttgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagcttta |
36871607 |
T |
 |
| Q |
244 |
gtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36871608 |
gtgcaccgggttgccct |
36871624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 39914440 - 39914308
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||| |||||| ||| ||||||| ||||||||||||| | |||||||| || ||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
39914440 |
aaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccgaatggtgggacccctt-cctgaccctg |
39914342 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| |
|
|
| T |
39914341 |
cgtatgcgggagctttagtgcatcgggttgccct |
39914308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 24200761 - 24200625
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| | ||||||||||||| ||||||||||||||||||||||||| || |||||||| ||||| ||||||| |
|
|
| T |
24200761 |
gaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaacccttcccggacc |
24200662 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||| ||||| | ||||||| ||||||||||||||||| |
|
|
| T |
24200661 |
ctgagtatgtgagagctttagtgcaccgggttgccct |
24200625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 11514437 - 11514568
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||||||||||||| ||||| ||||| | ||||||||||||| | |||||||||||||||||||||| ||||||||||||| || || |||||||| |
|
|
| T |
11514437 |
aaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaaggctgcgtacaatacaccaaatggtgggaccc-ttcccagaccctgc |
11514535 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||| |
|
|
| T |
11514536 |
gtatgcgggagctttagtgcaccggattgccct |
11514568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 127 - 252
Target Start/End: Original strand, 25641501 - 25641626
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||| |||||| |||| ||||||| | ||||||||||||||| ||| |||||||||||| ||| | |||| |
|
|
| T |
25641501 |
gaaaggtcacgggttcaagtcctggaaacagcattttgtgtgaaaacagggtaaagttgcgtacaatacaccaaattgtgggaccccttcccgaatcctg |
25641600 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
|||||||| ||||||| ||| ||||| |
|
|
| T |
25641601 |
cgtatgcgagagctttagtgaaccgg |
25641626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 127 - 243
Target Start/End: Complemental strand, 32781424 - 32781307
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||||| ||||||||| | ||||||| ||||||||||||| |||||||| |||||||||||||||| |||||||||||||||| || |||||| |
|
|
| T |
32781424 |
gaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccct |
32781325 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttg |
243 |
Q |
| |
|
| |||||||||||||||| |
|
|
| T |
32781324 |
gtgtatgcgggagctttg |
32781307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 5841029 - 5841163
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||||||||||||||| ||||| | | ||||||||||| |||||||||| ||||||||||||| | | ||||||||||||||| |||||||| |
|
|
| T |
5841029 |
aaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaatagggtaaggatgcgtacaatacatcaataatggtgggaccccttcccggacccc |
5841128 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| |||||||||||||| |||||||| |||||||| |
|
|
| T |
5841129 |
gcatatgcgggagctttagtgcaccgagttgccct |
5841163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 253
Target Start/End: Complemental strand, 17380372 - 17380247
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||| ||| ||||||||| || || ||||||||| |||| ||| ||||||| | |||||||| |
|
|
| T |
17380372 |
gaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaacagggtaaggttgtgtgcaatacaccaaatgatggaaccccttcctggaccctg |
17380273 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccggg |
253 |
Q |
| |
|
|| ||||||||||||| |||||||||| |
|
|
| T |
17380272 |
cggatgcgggagcttt-gtgcaccggg |
17380247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 130 - 231
Target Start/End: Original strand, 22371059 - 22371158
Alignment:
| Q |
130 |
aggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgt |
229 |
Q |
| |
|
||||||||||||||||||||| ||||| | || ||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| || |
|
|
| T |
22371059 |
aggtcacgggttcaagtcctggaaacagcctc--gtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgtgt |
22371156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 129 - 258
Target Start/End: Complemental strand, 24860120 - 24859992
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
||||| ||||||| ||| |||| ||||||| ||| ||||||||| | |||| |||||||||||||||||| |||||| | ||||||| ||||||||||| |
|
|
| T |
24860120 |
aaggttacgggtttaagccctggaaacaacctctggtgtaaaaacatggta-ggctgcgtacaatacaccaaatggtagaaccccttctcggaccctgcg |
24860022 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| |
|
|
| T |
24860021 |
tatgcgggagctttagtgcaccggattgcc |
24859992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 127 - 250
Target Start/End: Complemental strand, 19977850 - 19977726
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||||||||||||| ||| ||||| | |||| |||||||| |||| ||||| ||||||||||||||| |||||||||| ||||| ||| ||| | |
|
|
| T |
19977850 |
gaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaataggataaggttgcgtacaatacaccaaatggtgggatcccttcccgaacctt |
19977751 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
| ||||||||||||||| ||||||| |
|
|
| T |
19977750 |
gtgtatgcgggagctttagtgcacc |
19977726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 127 - 243
Target Start/End: Original strand, 33795284 - 33795401
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaa-tacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||||| ||||||| ||||||||||||||||||| |||||| | |||||||||||||| || ||||| |
|
|
| T |
33795284 |
gaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacaccta-tggtgggaccccttcccagaccc |
33795382 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttg |
243 |
Q |
| |
|
|| |||||||||||||||| |
|
|
| T |
33795383 |
tgtgtatgcgggagctttg |
33795401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 252
Target Start/End: Complemental strand, 26684758 - 26684630
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaaca-acatcttgtgtaaaaa--tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||| |||| |||||||||||||| || ||||||||||||| || ||||||||||||||||||| || |||||||||||| ||| ||| ||| |
|
|
| T |
26684758 |
gaaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggtaaggctgcgtacaatatactaaatggtgggacctcttcccgaacc |
26684659 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
26684658 |
ctgcgtatgcgggagctttaatgcaccgg |
26684630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 175 - 260
Target Start/End: Complemental strand, 40762321 - 40762236
Alignment:
| Q |
175 |
gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| || | |||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
40762321 |
gggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcaccgggttgccct |
40762236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 40417005 - 40416873
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||| |||||| |||| ||||||| |||||||||||| | || |||||||| || ||||||||| |
|
|
| T |
40417005 |
aaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaattgatgggacccttttttggaccctgc |
40416906 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| |
|
|
| T |
40416905 |
atatgcgagagctttagtgcaccgggttgccct |
40416873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 21377209 - 21377076
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||| ||| ||||||||| | ||||| | ||||||||||||| |||||||||||| ||||||| |||| |||||||||||||||| ||| ||||| |
|
|
| T |
21377209 |
gaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaatggtgggaccccttcccgaaccct |
21377110 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||| ||||||||| |||||||| | |||||| |
|
|
| T |
21377109 |
gcgtatgtgggagcttt-gtgcaccgagctgccct |
21377076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 127 - 225
Target Start/End: Original strand, 5450284 - 5450384
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt--aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||| |||||||| ||||| | ||||||||||||||||||||||| || ||||||||||||| | |||||| |
|
|
| T |
5450284 |
gaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagggtgggaccccttcctggaccc |
5450383 |
T |
 |
| Q |
225 |
t |
225 |
Q |
| |
|
| |
|
|
| T |
5450384 |
t |
5450384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 168 - 260
Target Start/End: Original strand, 25632550 - 25632642
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| ||| ||||||||||||||||||||| |||||||||| |||| ||| ||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
25632550 |
aaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccct |
25632642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 168 - 260
Target Start/End: Original strand, 44643564 - 44643656
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| || ||||||||||||||||| ||| |||||||||||||||| || |||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
44643564 |
aaaaacagagtaaggctgcgtacaatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccct |
44643656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 99399 - 99285
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||| ||||| | || |||||||||||||||||||| |||||||| ||||||| | ||||||| |
|
|
| T |
99399 |
gaaaggtcacgggttcaagtcctagaaacagcctcttgta-aaaaacatggcaaggctgcgtacaatacaccaaatggtggaaccccttctcagaccctg |
99301 |
T |
 |
| Q |
227 |
cgtatgcgggagcttt |
242 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
99300 |
tgtatgcgggagcttt |
99285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 143 - 250
Target Start/End: Original strand, 30826052 - 30826158
Alignment:
| Q |
143 |
aagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||| || ||||| | ||||||||||||||||||||||| ||||||||||||||| |||||| ||| ||||| || |||||| | |||||||||||||| |
|
|
| T |
30826052 |
aagtcttggaaacagcctcttgtgtaaaaatagggtaaggttgcgtacaatacaccaaatggt-ggaacccttcccagaccctacatatgcgggagcttt |
30826150 |
T |
 |
| Q |
243 |
ggtgcacc |
250 |
Q |
| |
|
||||||| |
|
|
| T |
30826151 |
agtgcacc |
30826158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 129 - 260
Target Start/End: Complemental strand, 13245220 - 13245097
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
228 |
Q |
| |
|
||||||||| |||||||||||| ||||||| |||||||| |||||||||||||||| ||||| |||||||||||||||| ||||||| ||| |
|
|
| T |
13245220 |
aaggtcacgagttcaagtcctggaaacaacctcttgtgt--------ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgca |
13245129 |
T |
 |
| Q |
229 |
tatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||| |||||||||| ||| | ||||||||||| |
|
|
| T |
13245128 |
tatacgggagctttagtgtatcgggttgccct |
13245097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 127 - 224
Target Start/End: Complemental strand, 23145834 - 23145736
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||| || |||||||||||||||||||||| | ||||||||||| || |||||||| |
|
|
| T |
23145834 |
gaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc |
23145736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 127 - 224
Target Start/End: Complemental strand, 23557624 - 23557526
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||| || |||||||||||||||||||||| | ||||||||||| || |||||||| |
|
|
| T |
23557624 |
gaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaattggtgggaccctttcccggaccc |
23557526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 259
Target Start/End: Complemental strand, 4516487 - 4516354
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| ||||||| || ||||| | ||||||||||||| |||| || ||||||||||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
4516487 |
gaaaggtcacatattcaagttctagaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaattggtgggaccccttcccggaccct |
4516388 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
||||||| || |||||| ||| |||||| ||||| |
|
|
| T |
4516387 |
gcgtatgtggaagctttagtgtaccgggctgccc |
4516354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 176 - 249
Target Start/End: Original strand, 24890460 - 24890533
Alignment:
| Q |
176 |
ggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||||||||| ||||||||||||||||| |||||||| |||||| |
|
|
| T |
24890460 |
ggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 27573620 - 27573753
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||| ||||||||||| | |||| | ||||||||| ||| | ||||||||||||||||||||||| |||||||| ||| || || |||||| |
|
|
| T |
27573620 |
gaaaggtcattggttcaagtccgggcaacagcctcttgtgtataaacatggtaaggctgcgtacaatacaccaaatggtggaaccatttcccaaaccctg |
27573719 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
27573720 |
tgtatgtgggagctttagtgcatcgggttgccct |
27573753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 161 - 250
Target Start/End: Complemental strand, 39499331 - 39499242
Alignment:
| Q |
161 |
cttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| | |||||||||| ||||| || | |||||||||||||||||||| ||||||| |
|
|
| T |
39499331 |
cttgtataaaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcacc |
39499242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 201 - 260
Target Start/End: Complemental strand, 40579810 - 40579751
Alignment:
| Q |
201 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccct |
40579751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 200 - 257
Target Start/End: Original strand, 23488556 - 23488613
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgc |
257 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
23488556 |
aatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgc |
23488613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 143 - 252
Target Start/End: Complemental strand, 30864536 - 30864427
Alignment:
| Q |
143 |
aagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||| || ||||| | ||||||||||||||||||||||| ||||||||||| ||| |||||| || || || || ||||||||||||||| ||||| |
|
|
| T |
30864536 |
aagtcatggaaacagcctcttgtgtaaaaatagggtaagggtgcgtacaatataccaaatggtaagatcctttcccaaaccctgcgtatgcggaagcttc |
30864437 |
T |
 |
| Q |
243 |
ggtgcaccgg |
252 |
Q |
| |
|
|||||||||| |
|
|
| T |
30864436 |
ggtgcaccgg |
30864427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 258
Target Start/End: Original strand, 7214533 - 7214667
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacac--cgaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||| ||||||||||| || ||||| |||||||||||| | |||||||||||||||||||||||| ||||||| || ||||| ||||| |
|
|
| T |
7214533 |
gaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaaggctgcgtacaatacacaaaaaatggtgagatcccttctcggaca |
7214632 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||||||| ||| ||| ||||||| ||||||| |
|
|
| T |
7214633 |
ctgcgtatgcgagagttttagtgcaccaggttgcc |
7214667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 250
Target Start/End: Original strand, 19614991 - 19615116
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||||||||||||||||| ||||| | |||||| | ||||| |||||||| |||||||||||| ||| ||| || ||||||||| ||| ||| |
|
|
| T |
19614991 |
gaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagt-ggaccccttcccgaacc |
19615089 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcacc |
250 |
Q |
| |
|
|||||||||| |||||||| ||||||| |
|
|
| T |
19615090 |
ctgcgtatgcaggagctttagtgcacc |
19615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 201 - 260
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
| Q |
201 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 168 - 242
Target Start/End: Complemental strand, 31821437 - 31821363
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||||||||||||| || |||||||||||| |||| ||||||||||| ||| | |||| ||||||||||||||| |
|
|
| T |
31821437 |
aaaaatagggtaaggttgtgtacaatacaccaaatgatgggacccctttccgaaacctgtgtatgcgggagcttt |
31821363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 260
Target Start/End: Original strand, 34080176 - 34080234
Alignment:
| Q |
202 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccct |
34080234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 202 - 260
Target Start/End: Original strand, 34766330 - 34766388
Alignment:
| Q |
202 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttccct |
34766388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 137 - 260
Target Start/End: Complemental strand, 15296533 - 15296408
Alignment:
| Q |
137 |
gggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcg |
234 |
Q |
| |
|
|||||||||||| | ||||| | | |||||||||| | ||||||||||||||||||||| ||| || | |||||| ||||| ||||||||||||||| | |
|
|
| T |
15296533 |
gggttcaagtcccggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaaatagtgggatcccttctcggaccctgcgtatgtg |
15296434 |
T |
 |
| Q |
235 |
ggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||||||||| || || |||||| |
|
|
| T |
15296433 |
gaagctttggtgcgccaggctgccct |
15296408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 127 - 238
Target Start/End: Complemental strand, 44449519 - 44449407
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||||| |||||| |||| |||||||| ||||| | ||||| ||| ||||||||||||||||||||| || | |||||||||||| |||||||| |
|
|
| T |
44449519 |
gaaaggtcacgagttcaa-tcctaaaaacaacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaaaatagtgggaccccttcccggaccc |
44449421 |
T |
 |
| Q |
225 |
tgcgtatgcgggag |
238 |
Q |
| |
|
||||| || ||||| |
|
|
| T |
44449420 |
tgcgtttgtgggag |
44449407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 12 - 68
Target Start/End: Original strand, 14516960 - 14517015
Alignment:
| Q |
12 |
tagtcattgccaaatgaaaaggcaaaaccaacctagtttgcaaaggatgcaacctgt |
68 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
14516960 |
tagtcattgcaaaatgaaaaggcaaa-ccaacctagtttccaaaggatgcaacctgt |
14517015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 336
Target Start/End: Original strand, 14522050 - 14522101
Alignment:
| Q |
285 |
atgatattgattctacatctgttggtatagaagcagaggcgtataggttttc |
336 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
14522050 |
atgatattgattctacatatgtttgtatagaagcagaggtgtataggttttc |
14522101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 217 - 260
Target Start/End: Original strand, 22371202 - 22371245
Alignment:
| Q |
217 |
ccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22371202 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
22371245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 31158577 - 31158459
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||| ||||| ||||| | |||||| | ||||| ||||||| |||||||| ||| ||||||| ||| || |||||||||||||| || |||| |
|
|
| T |
31158577 |
gaaaggtcaagggttaaagtcttcaaaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaatggtgggaccccttcccagacc |
31158478 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagcttt |
242 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31158477 |
ctgcgtatgcgggagcttt |
31158459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 259
Target Start/End: Complemental strand, 45235954 - 45235820
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa--atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||| ||||| ||||||||||| ||||| |||| ||||||| ||||||||||||| ||| ||||||| |||||||||||||||| || ||||| |
|
|
| T |
45235954 |
gaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataatagggtaaggctacgtgtaatacacaaaatggtgggaccccttaccagaccc |
45235855 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
| ||||||| |||||||| ||| ||| ||||||| |
|
|
| T |
45235854 |
tacgtatgcaggagctttagtgtaccaagttgccc |
45235820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 217 - 258
Target Start/End: Complemental strand, 124959 - 124918
Alignment:
| Q |
217 |
ccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
124959 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 207 - 260
Target Start/End: Original strand, 8575975 - 8576028
Alignment:
| Q |
207 |
ggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgccct |
8576028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 14544139 - 14544199
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| ||||||||| | |||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
14544139 |
aatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgccct |
14544199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 129 - 181
Target Start/End: Original strand, 44604855 - 44604907
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaag |
181 |
Q |
| |
|
|||||||| ||||||||||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
44604855 |
aaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaag |
44604907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 288 - 343
Target Start/End: Original strand, 14517067 - 14517122
Alignment:
| Q |
288 |
atattgattctacatctgttggtatagaagcagaggcgtataggttttcaatgttt |
343 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
14517067 |
atattgattctacatatgtttgtatagaagcaaaggtgtataggttctcaatgttt |
14517122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 191 - 242
Target Start/End: Complemental strand, 24059067 - 24059016
Alignment:
| Q |
191 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
24059067 |
aatacaccatatggtgggacccctttccggaccctgcgtatgtgggagcttt |
24059016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 198
Target Start/End: Complemental strand, 29420025 - 29419949
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagg----gtaaggctgcgtacaatacacc |
198 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| ||||||||| |||| ||| |||||||||||||||||||||| |
|
|
| T |
29420025 |
gaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagtaaggctgcgtacaatacacc |
29419949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 192 - 259
Target Start/End: Original strand, 31525771 - 31525838
Alignment:
| Q |
192 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
||||||| |||| |||||||| ||||| |||||||| |||||||||||||| ||| ||||| |||||| |
|
|
| T |
31525771 |
atacaccaaatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc |
31525838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 129 - 198
Target Start/End: Original strand, 17705496 - 17705566
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaa-aatagggtaaggctgcgtacaatacacc |
198 |
Q |
| |
|
|||||||||||||||||||||| |||| | ||||||||||| || || ||||||||| |||||||||||| |
|
|
| T |
17705496 |
aaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaaggctgtgtacaatacacc |
17705566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 208 - 260
Target Start/End: Complemental strand, 3633762 - 3633710
Alignment:
| Q |
208 |
gaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||| |||||||| |||||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccct |
3633710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 44521509 - 44521393
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||||| |||||| || || |||||| ||||||||||||| | ||||||||||| || |||||||| ||||| |||| ||||| || ||| | |
|
|
| T |
44521509 |
gaaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaatggcgggagcccttcccagacatt |
44521410 |
T |
 |
| Q |
226 |
gcgtatgcgggagcttt |
242 |
Q |
| |
|
|| ||| |||||||||| |
|
|
| T |
44521409 |
gcatatacgggagcttt |
44521393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 206
Target Start/End: Complemental strand, 2003673 - 2003592
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaatggtg |
206 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| | |||| ||||||| | |||||||| ||||||||||||| | ||||||| |
|
|
| T |
2003673 |
gaaaggtcacgggtacaagtcctggaaacagccccttgcgtaaaaaaacagggtaaggatgcgtacaatacaacaaatggtg |
2003592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 200 - 242
Target Start/End: Complemental strand, 19185805 - 19185763
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
242 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
19185805 |
aatggtggaaccccttcctggaccctgcgtatgcgggagcttt |
19185763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 1289095 - 1289156
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagc-tttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||||| | ||| ||||||||||| ||| ||||||||| ||||||| |
|
|
| T |
1289095 |
aatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgccct |
1289156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 215
Target Start/End: Complemental strand, 12315787 - 12315699
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggacccctt |
215 |
Q |
| |
|
||||||||||| ||||||||| || ||||| | |||| | ||||| |||||||| ||| |||||||||||| ||| ||| ||| |||| |
|
|
| T |
12315787 |
gaaaggtcacgagttcaagtcatggaaacagcttcttattaaaaaacagggtaagactgtgtacaatacaccaaatagtgagactcctt |
12315699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 220 - 260
Target Start/End: Complemental strand, 23053007 - 23052967
Alignment:
| Q |
220 |
gaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| |||||| |
|
|
| T |
23053007 |
gaccctgcgtatgcaggagcttttgtgcaccgggctgccct |
23052967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 13159 - 13026
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | ||||| ||||||| | |||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
13159 |
gaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaacaaggtaaggctgcgtacaatacaccgaatggtgggaccccttcccagaccctg |
13060 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| |
|
|
| T |
13059 |
cgtatgcgggggctttagtgcaccgggttgccct |
13026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 133 - 172
Target Start/End: Original strand, 16733 - 16772
Alignment:
| Q |
133 |
tcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
16733 |
tcacgggttcaagtcctgaaaacaacttcttatgtaaaaa |
16772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 90; Significance: 2e-43; HSPs: 46)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 29355993 - 29355857
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaa-aaatagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||| ||| ||||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
29355993 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacc |
29355894 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29355893 |
ctgcgtatgcgggagctttagtgcaccgggttgccct |
29355857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 1346963 - 1347095
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | ||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
1346963 |
gaaaggtcacgggttcaagtcctggaaacagccacttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
1347061 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
1347062 |
catatgcgggagctctagtgcaccgggttgccct |
1347095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 1354891 - 1354759
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
1354891 |
gaaaggtcactggttcaagtcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
1354793 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
1354792 |
catatgcgggagctctagtgcaccgggttgccct |
1354759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 12222053 - 12221916
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
||||||||||||||||||||| || ||||| | ||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
12222053 |
gaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggacc |
12221954 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagc-tttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12221953 |
ctgcgtatgcgggagcttttagtgcaccgggttgccct |
12221916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 9161122 - 9161257
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | ||||||||||||| || |||||||||||||||||||| | |||||||||||||||| ||||||| |
|
|
| T |
9161122 |
gaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacagagtaaggctgcgtacaatacatcaataatggtgggaccccttctcggaccc |
9161221 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
9161222 |
tgcgtatgcggaagctttagtgcaccaggttgccct |
9161257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 2166548 - 2166412
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||| | ||| ||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
2166548 |
gaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggacc |
2166449 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
2166448 |
ctatatattcgggagctttagtgcaccgggttgccct |
2166412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 2178181 - 2178045
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||| | ||| ||||| ||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
2178181 |
gaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataatggtgggaccccttcccggacc |
2178082 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
2178081 |
ctatatattcgggagctttagtgcaccgggttgccct |
2178045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 146 - 260
Target Start/End: Original strand, 26097178 - 26097291
Alignment:
| Q |
146 |
tcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggt |
245 |
Q |
| |
|
||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||| |||||||||| ||||||||||| |||||||||||| | || |
|
|
| T |
26097178 |
tcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagt |
26097276 |
T |
 |
| Q |
246 |
gcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26097277 |
gcaccgggttgccct |
26097291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 129 - 260
Target Start/End: Original strand, 1941856 - 1941988
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
|||||| ||| || ||||| || ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| | | ||| | || |
|
|
| T |
1941856 |
aaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccatcctggatcttgt |
1941955 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||| ||| |||||||| |||||||| |
|
|
| T |
1941956 |
gtatgcgggagtttttgtgcaccgtgttgccct |
1941988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 127 - 249
Target Start/End: Complemental strand, 7947508 - 7947384
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||| ||||||| ||||| ||||||| || |||||||||| ||||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
7947508 |
gaaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggacct |
7947409 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcac |
249 |
Q |
| |
|
|||||||| ||||||||| |||||| |
|
|
| T |
7947408 |
tgcgtatgtgggagctttagtgcac |
7947384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 133 - 251
Target Start/End: Original strand, 33138838 - 33138957
Alignment:
| Q |
133 |
tcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
231 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||| |||||| || ||||||| |||||||||||||| ||||||||||||| || |||||||||| |||| |
|
|
| T |
33138838 |
tcacgggttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtat |
33138937 |
T |
 |
| Q |
232 |
gcgggagctttggtgcaccg |
251 |
Q |
| |
|
|| | |||||| |||||||| |
|
|
| T |
33138938 |
gcagtagctttagtgcaccg |
33138957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 146 - 260
Target Start/End: Original strand, 25557743 - 25557856
Alignment:
| Q |
146 |
tcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggt |
245 |
Q |
| |
|
||||| ||||| | |||||||||||| ||||||||||||||||||||||||| |||| || ||||||| ||||||||||| |||||||||||| | || |
|
|
| T |
25557743 |
tcctggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagt |
25557841 |
T |
 |
| Q |
246 |
gcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25557842 |
gcaccgggttgccct |
25557856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 255
Target Start/End: Complemental strand, 3815213 - 3815084
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||| ||||||||||||||||||| ||||| | ||||||||||| || |||| | |||||||||||||||| ||||||||||||| || ||| ||||| |
|
|
| T |
3815213 |
gaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacgactgcgtacaatacaccaaatggtgggaccctttcccgaaccct |
3815114 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggtt |
255 |
Q |
| |
|
||||||||| |||||| |||||||||||| |
|
|
| T |
3815113 |
acgtatgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 138 - 242
Target Start/End: Original strand, 32579436 - 32579540
Alignment:
| Q |
138 |
ggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcggga |
237 |
Q |
| |
|
||||||||||||| ||||| | ||| || |||||||| |||||| ||||||||||||| || |||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
32579436 |
ggttcaagtcctggaaacagcctctggtataaaaatacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcggga |
32579535 |
T |
 |
| Q |
238 |
gcttt |
242 |
Q |
| |
|
||||| |
|
|
| T |
32579536 |
gcttt |
32579540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 127 - 259
Target Start/End: Complemental strand, 13905115 - 13904984
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgta-aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||||||| ||||||||||||||| || ||||||||| |||| ||||||||||||| |||||| |||| |||||| |||||| || ||| ||||| |
|
|
| T |
13905115 |
gaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaaggctgcatacaattcaccaaatggt-ggaccctttcccgaaccct |
13905017 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccc |
259 |
Q |
| |
|
|||||| |||||||| |||||||||| ||||| |
|
|
| T |
13905016 |
gcgtatcacggagcttt-gtgcaccgggctgccc |
13904984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 128 - 256
Target Start/End: Complemental strand, 18277328 - 18277199
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||||||||||| || || ||||| | |||||||||||||| ||||||||| || ||||| ||||| |||||||||||||||| | ||| || |
|
|
| T |
18277328 |
aaaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggaccccttcctagactcta |
18277229 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttg |
256 |
Q |
| |
|
|||||||||||||||| |||||||||||| |
|
|
| T |
18277228 |
cgtatgcgggagctttactgcaccgggttg |
18277199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 190 - 260
Target Start/End: Original strand, 13267788 - 13267858
Alignment:
| Q |
190 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||| |||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13267788 |
caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccct |
13267858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 17432339 - 17432481
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaa-------tagggtaaggctgcgtacaatacac--cgaatggtgggaccccttgc |
217 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||| ||||||||||| ||||||| |||| || | |
|
|
| T |
17432339 |
gaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagggtaaggctgtgtacaatacactaaaaatggtgagaccttttcc |
17432438 |
T |
 |
| Q |
218 |
cggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| |||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
17432439 |
cggatcctgtgcatgcgggagctttagtgcaccgggttgccct |
17432481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 23240958 - 23240826
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||| | |||||||||||| |||||||| ||||||||||| ||| | |||||||||||||| |||| || |
|
|
| T |
23240958 |
gaaaggtcacaggtgcaagtcctggaaacagcctcttgtgtaaaac-agggtaagtttgcgtacaatataccaattggtgggaccccttctaggacaatg |
23240860 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| |||||| ||| |||||| |
|
|
| T |
23240859 |
cgtatgcgggagctttagtgcactgggctgccct |
23240826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 6808468 - 6808528
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
6808468 |
aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccct |
6808528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 184 - 260
Target Start/End: Complemental strand, 23930205 - 23930129
Alignment:
| Q |
184 |
tgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
23930205 |
tgcgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccct |
23930129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 12889425 - 12889560
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaatgg-tgggaccccttgccggaccc |
224 |
Q |
| |
|
|||||||||| |||||||||| |||||||| | |||||||| ||||| |||| |||||||| ||||||||||| || | ||||||||||| |||||||| |
|
|
| T |
12889425 |
gaaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcatacaatacacctaaacgatgggacccctttccggaccc |
12889524 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| || || ||||||||| ||||| |||| |||||| |
|
|
| T |
12889525 |
tctgtgtgtgggagctttagtgcatcgggctgccct |
12889560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 15866173 - 15866041
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||| |||||||| ||||| ||||| | |||| ||||||| ||||||| |||||||| ||||||| |||||||||||||||| ||||||||| |
|
|
| T |
15866173 |
gaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcccggaccct |
15866076 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| ||||||| || | |||||| | |||||||| |
|
|
| T |
15866075 |
gcgtttgcgggatctatagtgcactgagttgccct |
15866041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 128 - 215
Target Start/End: Original strand, 28007628 - 28007714
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggacccctt |
215 |
Q |
| |
|
||||||||||||||||||||||| ||| | | |||||||||||| ||||| ||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
28007628 |
aaaggtcacgggttcaagtcctggaaagagcctcttgtgtaaaac-agggtcaggctgcgtacaatacaccaaatgctgggacccctt |
28007714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 12885986 - 12886046
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
12885986 |
aatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccct |
12886046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 260
Target Start/End: Original strand, 12892082 - 12892142
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
12892082 |
aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
12892142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 128 - 240
Target Start/End: Original strand, 14553511 - 14553626
Alignment:
| Q |
128 |
aaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||| ||||||||||||| ||| | | |||||||| |||||||||||||||||| ||| |||||||| || |||||||||||||| ||||| |
|
|
| T |
14553511 |
aaaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtataatacaccaaaactggtgggaccccttcgtagaccc |
14553610 |
T |
 |
| Q |
225 |
tgcgtatgcgggagct |
240 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
14553611 |
tgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 129 - 238
Target Start/End: Original strand, 22967172 - 22967287
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgc------gtacaatacaccgaatggtgggaccccttgccggac |
222 |
Q |
| |
|
|||||||| ||||||||| || ||||||| ||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
22967172 |
aaggtcactagttcaagtcatggaaacaacttcttgtgtaaaaataggataaggctgcatacaaatacaatacaccaaatggtgggaccccttcttggac |
22967271 |
T |
 |
| Q |
223 |
cctgcgtatgcgggag |
238 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
22967272 |
cctgcctatgcgggag |
22967287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 129 - 238
Target Start/End: Complemental strand, 23821221 - 23821106
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgc------gtacaatacaccgaatggtgggaccccttgccggac |
222 |
Q |
| |
|
|||||||| ||||||||| || ||||||| ||||||||||||||||| ||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
23821221 |
aaggtcactagttcaagtcatggaaacaacttcttgtgtaaaaataggataaggctgcatacaaatacaatacaccaaatggtgggaccccttcttggac |
23821122 |
T |
 |
| Q |
223 |
cctgcgtatgcgggag |
238 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
23821121 |
cctgcctatgcgggag |
23821106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 185 - 260
Target Start/End: Complemental strand, 383837 - 383762
Alignment:
| Q |
185 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| | |||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
383837 |
gcgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgccct |
383762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 3116259 - 3116131
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccc |
224 |
Q |
| |
|
||||||||| ||||||||||| || ||||||| |||||| ||||||| | ||||| |||||||||| || |||||||||||||| |||||| |
|
|
| T |
3116259 |
gaaaggtcatgggttcaagtcatggaaacaacctcttgtataaaaat-------gactgcgcacaatacaccaaaaatggtgggaccccttctcggacct |
3116167 |
T |
 |
| Q |
225 |
tgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||||| |
|
|
| T |
3116166 |
tgcgtatgcgggagctttagtacaccggattgccct |
3116131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 192
Target Start/End: Original strand, 17448323 - 17448389
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaa |
192 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||| ||||| ||||||||||||||||||| |
|
|
| T |
17448323 |
gaaaggtcacgggttcaagttttgaaaacaacattttgtgtaaaaaacagggtaaggctgcgtacaa |
17448389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 24097580 - 24097710
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
||||||||||| ||| ||||||| || || | |||||| |||||| ||||||||||||| ||||| || |||||||||||||||| ||||||||| |
|
|
| T |
24097580 |
gaaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttacaa----ccaaatggtgggaccccttcccggaccct |
24097675 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||| |||||| ||| || ||||||||| |
|
|
| T |
24097676 |
gcgtatgcggaagctttagtgtcccaggttgccct |
24097710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 132 - 189
Target Start/End: Complemental strand, 4136648 - 4136590
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgta |
189 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
4136648 |
gtcacgggttcaagtcctaaaaacaacatcttgtgtaaaatacagggtaaggttgcgta |
4136590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 202 - 260
Target Start/End: Complemental strand, 10734965 - 10734907
Alignment:
| Q |
202 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||| || ||||||| |||||| |
|
|
| T |
10734965 |
tggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgccct |
10734907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 126 - 260
Target Start/End: Complemental strand, 15865993 - 15865859
Alignment:
| Q |
126 |
ggaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||| | |||| ||||||| | |||||| |||||||| ||||||| |||||||||||||||| | ||||| |
|
|
| T |
15865993 |
ggaaaggtcatgggttcaattcctggaaacagcctcttacgtaaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcctggacc |
15865896 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||| |||| || || | |||||| | |||||||| |
|
|
| T |
15865895 |
ctgcgtttgcgtgatctatagtgcactgagttgccct |
15865859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 195
Target Start/End: Original strand, 8409242 - 8409311
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatac |
195 |
Q |
| |
|
|||||||||||| ||||||||||| |||| | |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
8409242 |
gaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggtaaggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 202 - 252
Target Start/End: Original strand, 11395836 - 11395886
Alignment:
| Q |
202 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
252 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| || |||||| |
|
|
| T |
11395836 |
tggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 258
Target Start/End: Complemental strand, 14975152 - 14975094
Alignment:
| Q |
200 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||||||| ||| |||| || |||||||||| ||| ||||||||||||||| |
|
|
| T |
14975152 |
aatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 127 - 251
Target Start/End: Original strand, 20400666 - 20400791
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| ||||||||| || |||||| |||||||| ||||| |||||||| ||||||||| ||||| ||| | ||||||| || ||| ||||| |
|
|
| T |
20400666 |
gaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaagactgcgtacagtacactaaatagcgggacccttttccgaaccct |
20400765 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccg |
251 |
Q |
| |
|
||||||| | | |||| |||||||| |
|
|
| T |
20400766 |
acgtatgcagaaactttagtgcaccg |
20400791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 209 - 258
Target Start/End: Complemental strand, 30786427 - 30786378
Alignment:
| Q |
209 |
accccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
||||||| | ||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
30786427 |
accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgcc |
30786378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 261
Target Start/End: Original strand, 18254556 - 18254652
Alignment:
| Q |
165 |
tgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccctg |
261 |
Q |
| |
|
|||||||| ||||||| ||||| |||||||| | ||| |||||||||||| | ||| || ||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
18254556 |
tgtaaaaacagggtaaagctgcatacaatacccaaaatagtgggaccccttcacagactctacgtatatgggagttttggtgcaccgggctgccctg |
18254652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 235
Target Start/End: Original strand, 24734683 - 24734752
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccgaat--ggtgggaccccttgccggaccctgcgtatgcgg |
235 |
Q |
| |
|
||||| ||||||||| ||||||||||||| | || ||||||||||||| ||||| ||||||||||||| |
|
|
| T |
24734683 |
aaaaacagggtaaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgcgg |
24734752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 32728292 - 32728159
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccct |
225 |
Q |
| |
|
|||||||||| | ||||||| || ||||||| |||| |||||||| |||||||| ||| |||||||| ||| ||| |||| ||| || || |||||| |
|
|
| T |
32728292 |
gaaaggtcacagattcaagttttggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaatagtggt-ccctttcccagaccct |
32728194 |
T |
 |
| Q |
226 |
gcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||| |
|
|
| T |
32728193 |
acgtatgcgggaactttagtgcaccatgttgccct |
32728159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 138 - 232
Target Start/End: Original strand, 11849063 - 11849159
Alignment:
| Q |
138 |
ggttcaagtcctgaaaacaacatcttgtgt-aaaaatagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatg |
232 |
Q |
| |
|
||||||||||| | ||||||| |||||||| ||||| ||| ||| | ||| |||||||||| || |||||||||||||| ||| || ||||||||| |
|
|
| T |
11849063 |
ggttcaagtccaggaaacaacctcttgtgttaaaaacaggataaagttgcccacaatacaccaaaatggtgggaccccttcccgaactctgcgtatg |
11849159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 168 - 200
Target Start/End: Complemental strand, 14341164 - 14341132
Alignment:
| Q |
168 |
aaaaatagggtaaggctgcgtacaatacaccga |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
14341164 |
aaaaacagggtaaggctgcgtacaatacaccga |
14341132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 129 - 257
Target Start/End: Original strand, 10811 - 10940
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
227 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| |||||| |||||||| ||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
10811 |
aaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacaccaaatggtgggaccccttcccggaccctgc |
10910 |
T |
 |
| Q |
228 |
gtatgcgggagctttggtgcaccgggttgc |
257 |
Q |
| |
|
||||||||||||||| |||||| ||||||| |
|
|
| T |
10911 |
gtatgcgggagctttagtgcactgggttgc |
10940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 30578 - 30710
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | |||||||||||| |||||| |||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
30578 |
gaaaggtcaccggttcaagtcctggaaacagcctcttgtgtaaaac-agggtagggctgcgtacaatacaccaaatggtgggaccccttcccggaccctg |
30676 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||||||||||||| |
|
|
| T |
30677 |
catatgcgggagctctagtgcaccgggttgccct |
30710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 127 - 258
Target Start/End: Complemental strand, 1721 - 1591
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||||||||||| ||| ||||||||| ||||||||||| |||| ||||||||||| |||||||| | |
|
|
| T |
1721 |
gaaaggtcatgggttcaagtcctgaaaacaacctcttgtgtaaaac-aggataaggctgcatacaatacaccaaatgatgggaccccttcccggacccgg |
1623 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| |
|
|
| T |
1622 |
cgtatgcgggagctttagtgcaccaggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 137 - 260
Target Start/End: Complemental strand, 48758 - 48636
Alignment:
| Q |
137 |
gggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcggg |
236 |
Q |
| |
|
|||||||||| || ||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
48758 |
gggttcaagtggtggaaacagcctcttgtgtaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggg |
48660 |
T |
 |
| Q |
237 |
agctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||| | ||||||||||||||||| |
|
|
| T |
48659 |
agctctagtgcaccgggttgccct |
48636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 11130 - 11262
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| | | ||||||||| ||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
11130 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaag-taaggctgcttacaatacaccaaatggtgggacaccttcccggaccctg |
11228 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| |||||||||||| | ||||||| ||||||||| |
|
|
| T |
11229 |
catatgcgggagctctagtgcaccaggttgccct |
11262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 10184 - 10052
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| || ||||| |||||||||||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
10184 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac-agagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctg |
10086 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||| |||||| ||||||||||||||||| |
|
|
| T |
10085 |
catatgcaggagctccagtgcaccgggttgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Complemental strand, 20512 - 20380
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctg |
226 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||||||||| || ||||| |||||||||||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
20512 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaac-agagtaagactgcgtacaatacaccaaatagtgggaccccttcccggaccctg |
20414 |
T |
 |
| Q |
227 |
cgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
| ||||| |||||| ||||||||||||||||| |
|
|
| T |
20413 |
catatgcaggagctccagtgcaccgggttgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 127 - 260
Target Start/End: Original strand, 58976 - 59112
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggacc |
223 |
Q |
| |
|
|||||||||||||||||||||||| ||||| | |||||| |||||| |||||||| |||||||||||||||| || |||||||||||||| || ||| |
|
|
| T |
58976 |
gaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacaccaaaaatggtgggaccccttcccagact |
59075 |
T |
 |
| Q |
224 |
ctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
59076 |
ctgcgtatgcgggagctttagtgcatcgggttgccct |
59112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 175 - 260
Target Start/End: Complemental strand, 24220 - 24135
Alignment:
| Q |
175 |
gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||| ||||||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccct |
24135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 59; Significance: 6e-25; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 132 - 260
Target Start/End: Complemental strand, 72999 - 72869
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaaca-tcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgt |
229 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||| | ||||||||||| ||||||||||| |||||| | ||||||| ||||| ||||||| |
|
|
| T |
72999 |
gtcacgggttcaagtcctagaaacaagtctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgt |
72900 |
T |
 |
| Q |
230 |
atgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||||||||| ||||||| ||||||||| |
|
|
| T |
72899 |
atgcgggagctttagtgcaccaggttgccct |
72869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 160 - 260
Target Start/End: Original strand, 3576 - 3677
Alignment:
| Q |
160 |
tcttgtgtaaaa-atagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
258 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||||||||||| ||||||||||| ||| ||||||||||||||| |||||| |||||||| ||| || |
|
|
| T |
3576 |
tcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagctttagtgcaccgagtttcc |
3675 |
T |
 |
| Q |
259 |
ct |
260 |
Q |
| |
|
|| |
|
|
| T |
3676 |
ct |
3677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 129 - 212
Target Start/End: Complemental strand, 35152 - 35067
Alignment:
| Q |
129 |
aaggtcacgggttcaagtcctgaaaacaacatcttgtgta--aaaatagggtaaggctgcgtacaatacaccgaatggtgggaccc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35152 |
aaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccc |
35067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 127 - 225
Target Start/End: Original strand, 4156 - 4258
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaa-atagggtaaggctgcgtacaatacacc---gaatggtgggaccccttgccggac |
222 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||| | ||| ||||| ||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
4156 |
gaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacaccaataattggtgggaccccttcccggac |
4255 |
T |
 |
| Q |
223 |
cct |
225 |
Q |
| |
|
||| |
|
|
| T |
4256 |
cct |
4258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 135 - 243
Target Start/End: Original strand, 23606 - 23715
Alignment:
| Q |
135 |
acgggttcaagtcctgaaaacaacatcttgtgtaaaaat-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgc |
233 |
Q |
| |
|
||||||||||||| || ||||||| ||||||||||||| ||||| |||||||||||||| | | |||||||||||||||| || |||| || ||||| |
|
|
| T |
23606 |
acgggttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagcaaatggtgggaccccttcccagaccttgagtatgt |
23705 |
T |
 |
| Q |
234 |
gggagctttg |
243 |
Q |
| |
|
|||||||||| |
|
|
| T |
23706 |
gggagctttg |
23715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0867 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0867
Description:
Target: scaffold0867; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 132 - 212
Target Start/End: Complemental strand, 3798 - 3719
Alignment:
| Q |
132 |
gtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccc |
212 |
Q |
| |
|
|||| |||||||||| ||||||||||| |||||||||| | | ||||| | ||||||||||||||| ||||||||||||| |
|
|
| T |
3798 |
gtcatgggttcaagttctgaaaacaacc-cttgtgtaaatacaaggtaacgttgcgtacaatacaccaaatggtgggaccc |
3719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 211
Target Start/End: Complemental strand, 226542 - 226456
Alignment:
| Q |
127 |
gaaaggtcacgggttcaagtcctgaaaacaacatcttgtgtaaaaata--gggtaaggctgcgtacaatacaccgaatggtgggacc |
211 |
Q |
| |
|
|||||||||||| |||||||||| ||||| | |||||| |||||| | |||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
226542 |
gaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggtaaggctgcatacaatacatcaaatggtgggacc |
226456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 175 - 260
Target Start/End: Original strand, 24696 - 24781
Alignment:
| Q |
175 |
gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
260 |
Q |
| |
|
||||||| ||||||| |||||||| ||| |||| |||||| || |||||||||||| ||||||||| ||||||| | ||||||| |
|
|
| T |
24696 |
gggtaagactgcgtataatacaccaaatagtggaccccctttccagaccctgcgtatacgggagcttcagtgcacctgattgccct |
24781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 192 - 240
Target Start/End: Complemental strand, 58699 - 58651
Alignment:
| Q |
192 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagct |
240 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
58699 |
atacaccgaatggtgagaccccttctcggaccctgtgtatgcgggagct |
58651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University