View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13187_low_27 (Length: 264)
Name: NF13187_low_27
Description: NF13187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13187_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 21 - 254
Target Start/End: Complemental strand, 27940550 - 27940319
Alignment:
| Q |
21 |
tctaggtctatttgctcagtctcagatatttaccgttctgtgtcagaggtttagtttgagttgttcacttctctactccttgtggttttgtattttcatt |
120 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27940550 |
tctagatctattcgctcagtctcagatatttaccattctgtgtcagaggtttagtttgcgttgttcacttctg--ctccttgtggttttgtattttcatt |
27940453 |
T |
 |
| Q |
121 |
ctattgtgtttctagtttttgttgtgttgtcttgaggtacgacgttctccaacttcccttcaaccttcaattggattcagattcaagttatgatttgggt |
220 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
27940452 |
ctattatgtttccgatttttgttgtgttgtcttgaggttagacgttctccaacttcccttcaaccttcaattgtattcagattcaagttatgatctgggt |
27940353 |
T |
 |
| Q |
221 |
tttagtttcgttctctacgttttttagattcatc |
254 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
27940352 |
tttagtttcgttctctatgttttttagattcatc |
27940319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University