View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13187_low_31 (Length: 239)
Name: NF13187_low_31
Description: NF13187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13187_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 25614660 - 25614879
Alignment:
| Q |
1 |
ttttattcttaacttgttggatcagttcttctgagatctgcttggttttagttttggtttctttgatgaaacaacgattattcagtgatctaaagcaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614660 |
ttttattcttaacttgttggatcagttcttctgagatctacttggttttagttttggtttctttaatgaaacaacgattattcagtgatctaaagcaagc |
25614759 |
T |
 |
| Q |
101 |
tattccttctcaagattaaaactttttgagaaagatgaagaaaatataacatctgcatcccaaacctaaaaaatgtcttgagaatccaaagagtgaagaa |
200 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614760 |
tattccttctcaagatgaaaac-ttttgagaaagatgaagaaaatataacatctacatcccaaacctaaaaaatgtcttgagaatccaaagagtgaagaa |
25614858 |
T |
 |
| Q |
201 |
gaaaattttcaaggttactag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25614859 |
gaaaattttcaaggttactag |
25614879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University