View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13189_high_5 (Length: 302)
Name: NF13189_high_5
Description: NF13189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13189_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 33488719 - 33488937
Alignment:
| Q |
1 |
caggtggcctctgtcaaatctgtgtgcccaatctctttttaaacaatcatagaacttatgttcacttagtttcatatttatcctaattaagcataaggga |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33488719 |
caggtggcctctgtcaaatctatgtgcccaatctctttctaagcaatcatagaacttatgttcaattagtttcatatttatcctaattaagcataaggga |
33488818 |
T |
 |
| Q |
101 |
tgggcttttcaatttttcaaactaagaaatgttgctaattagaatcaaacaatatagcagctctttgcttgtgttagtttattatgcagatttttacttt |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33488819 |
tggacttttcaatttttcaaactaagaaatgttgctaattagaatcaaacaatatagcagctctttgcttctgttagtttattatgcagatttttacttt |
33488918 |
T |
 |
| Q |
201 |
agctttagaaactgtgtgc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33488919 |
agctttagaaactgtgtgc |
33488937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 257 - 290
Target Start/End: Original strand, 33488975 - 33489008
Alignment:
| Q |
257 |
gttcaggatttagtgttcctaattctttgtgatg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33488975 |
gttcaggatttagtgttcctaattctttgtgatg |
33489008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University